HUGE

Gene/Protein Characteristic Table for KIAA0440

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01667
Accession No. :	AB007900
Description :	Signal-induced proliferation-associated 1-like protein 1.
HUGO Gene Name :	signal-induced proliferation-associated 1 like 1 (SIPA1L1)
Clone Name :	ah05029 [Vector Info]
Flexi ORF Clone :	pF1KA0440
Source :	Human brain (amygdala)
Note :	We replaced hh00452, former representative clones for KIAA0440 with ah05029. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5737 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 240 bp

Genome contig ID gi51511730f_71024258
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AAAATTTTAAACAGTAAAATAAAAGTTTAACTGCT
Flanking genome sequence
(251615 - 251664)
----+----*----+----*----+----*----+----*----+----*
AAAATGTGAATGTCTTTATTTTTTTGCACAATATCTTTATCTGTTATGTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 71124258 71275871 21 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1817 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI46778	100.0	SIPA1L1 protein...	Homo sapiens
O43166	99.9	Signal-induced ...	Homo sapiens
XP_510040	99.7	signal-induced ...	Pan troglodytes
XP_001084201	99.4	similar to sign...	Macaca mulatta
XP_001488355	97.2	similar to high...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037810	3.8e-138	54.3	KIAA1389
AB011117	2.5e-108	51.2	KIAA0545
AB007943	4.1e-20	39.8	KIAA0474
AB028962	1.9e-17	50.0	KIAA1039
AB033098	0.00017	28.7	KIAA1272

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000331 642 830 PF02145 Rap/ran-GAP

IPR001478 967 1039 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 976 1042 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000331 613 830 PS50085 Rap/ran-GAP

IPR001478 967 1031 PS50106 PDZ/DHR/GLGF

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000331	642	830	PF02145	Rap/ran-GAP
IPR001478	967	1039	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	976	1042	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000331	613	830	PS50085	Rap/ran-GAP
IPR001478	967	1031	PS50106	PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CCCAAGTCCCCAAACAAAATG

Primer_r
: ACATCCAAGCATTCTGAAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCAAGTCCCCAAACAAAATG
Primer_r	: ACATCCAAGCATTCTGAAGTC
PCR product length	: 80 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	240 bp
Genome contig ID	gi51511730f_71024258
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAAATTTTAAACAGTAAAATAAAAGTTTAACTGCT
Flanking genome sequence (251615 - 251664)	----+--------+--------+--------+--------+----* AAAATGTGAATGTCTTTATTTTTTTGCACAATATCTTTATCTGTTATGTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	71124258	71275871	21	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0440

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information