HUGE

Gene/Protein Characteristic Table for KIAA1039

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05273
Accession No. :	AB028962
Description :	GTPase activating Rap/RanGAP domain-like 4 isoform 1.
HUGO Gene Name :	GTPase activating Rap/RanGAP domain-like 4 (GARNL4)
Clone Name :	fh02337 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5446 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4109 bp

Genome contig ID gi51511734f_2741384
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GCACATTGTATTTGTTAATGTACAAAACAAATTCT
Flanking genome sequence
(146324 - 146373)
----+----*----+----*----+----*----+----*----+----*
AAAAGGTTGACAAATGTATATTTTGTTGCTTAAATGTGTCTTTGCAGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 2841384 2887706 15 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 444 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW90526	1.6e-160	100.0	GTPase activati...	Homo sapiens
EAW90528	1.6e-160	100.0	GTPase activati...	Homo sapiens
BAC85912	1.7e-160	100.0	unnamed protein...	Homo sapiens
NP_001093868	1.7e-160	100.0	GTPase activati...	Homo sapiens
Q684P5	1.8e-160	100.0	Rap1 GTPase-act...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007943	1.2e-42	55.4	KIAA0474
AB007900	1.1e-18	50.0	KIAA0440
AB037810	1.6e-18	49.7	KIAA1389
AB011117	2e-18	49.7	KIAA0545
AB033098	0.00024	31.2	KIAA1272

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000331 1 178 PF02145 Rap/ran-GAP

ProfileScan IPR000331 1 178 PS50085 Rap/ran-GAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000331	1	178	PF02145	Rap/ran-GAP
ProfileScan	IPR000331	1	178	PS50085	Rap/ran-GAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GACTGCTGGCGTGTGAATGTG

Primer_r
: ATCTACGAATCACCTCCTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GACTGCTGGCGTGTGAATGTG
Primer_r	: ATCTACGAATCACCTCCTCAC
PCR product length	: 127 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4109 bp
Genome contig ID	gi51511734f_2741384
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACATTGTATTTGTTAATGTACAAAACAAATTCT
Flanking genome sequence (146324 - 146373)	----+--------+--------+--------+--------+----* AAAAGGTTGACAAATGTATATTTTGTTGCTTAAATGTGTCTTTGCAGAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	2841384	2887706	15	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1039

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information