HUGE |
Gene/Protein Characteristic Table for KIAA0083 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00400 |
---|---|
Accession No. : | D42046 |
Description : | DNA2-like helicase. |
HUGO Gene Name : | DNA replication helicase 2 homolog (yeast) (DNA2) |
Clone Name : | ha03631 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0083
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4207 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 973 bp Genome contig ID gi89161187r_69743883 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
AAGTTTTTTATTTAATAAATTTTTTCTACTAATGGFlanking genome sequence
(99945 - 99896) ----+----*----+----*----+----*----+----*----+----*
ATCTTAACTGTGTCAATTATTATTAATACTGAATAATAATTAAACTCAGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 10 r 69843828 69901678 21 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1077 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR014808 | 78 | 300 | PF08696 | DNA replication factor Dna2 |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 10 |
: Genebridge 4 | |
: CTATGTTTGGGGGTATCACTC | |
: AACCCTCAAGAGAAATGGAAG | |
: 180 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |