HUGE

Gene/Protein Characteristic Table for KIAA0625

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06791
Accession No. :	AB014525
Description :	Probable helicase senataxin.
HUGO Gene Name :	senataxin (SETX)
Clone Name :	hg04796s1 [Vector Info]
Flexi ORF Clone :	pF1KA0625
Source :	Human adult brain
Note :	We replaced hg04796, former representative clones for KIAA0625 with hg04796s1. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 10737 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2743 bp

Genome contig ID gi89161216r_134026704
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
GAGGAAATGGCAGAATTAAAAGCAGAAACAAGAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGGACATGGATTAGAGGTTATGTATTATGAAGTAAACTACAAGGTACTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 134126704 134214596 24 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 2663 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10365	100.0	senataxin [synt...	synthetic construct
CAI40854	99.9	senataxin [Homo...	Homo sapiens
AAR13367	99.8	ataxia/oculomot...	Homo sapiens
Q7Z333	99.8	Probable helica...	Homo sapiens
CAD98045	99.7	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86988	1.9e-13	29.8	KIAA0221
AB011132	1.3e-06	21.7	KIAA0560
D42046	0.00029	30.4	KIAA0083

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TTTGTCCCCAGAGTCAGCCAC

Primer_r
: GATAGAGCCCTTGACCCAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTTGTCCCCAGAGTCAGCCAC
Primer_r	: GATAGAGCCCTTGACCCAGAC
PCR product length	: 125 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2743 bp
Genome contig ID	gi89161216r_134026704
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GAGGAAATGGCAGAATTAAAAGCAGAAACAAGAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGACATGGATTAGAGGTTATGTATTATGAAGTAAACTACAAGGTACTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	134126704	134214596	24	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0625

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information