HUGE |
Gene/Protein Characteristic Table for KIAA0054 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07717 |
---|---|
Accession No. : | D29677 |
Description : | Probable helicase with zinc finger domain. |
HUGO Gene Name : | helicase with zinc finger (HELZ) |
Clone Name : | ha00503s1 [Vector Info] |
Flexi ORF Clone : | pF1KA0054
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha00503, former representative clones for KIAA0054 with ha00503s1. (2008/8/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6274 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 300 bp Genome contig ID gi51511734r_62404529 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CAAGCTAGCAGCCAAGAGGTTAATTGTGCAACTATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGAAAAGTTTGTCTAAAATGTATTTAAAAAGAAA
Features of the protein sequence |
Description | |
---|---|---|
Length: 1943 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000571 | 180 | 206 | PF00642 | Zinc finger |
IPR009818 | 1096 | 1113 | PF07145 | Ataxin-2 | |
HMMSmart | IPR000571 | 179 | 206 | SM00356 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 10 |
: Genebridge 4 | |
: TAACAAGCAGATCGCGGA | |
: GGTCGCTACTCTTCTTGG | |
: 143 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |