HUGE

Gene/Protein Characteristic Table for KIAA1404

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00228
Accession No. :	AB037825
Description :	NFX1-type zinc finger-containing protein 1.
HUGO Gene Name :	zinc finger, NFX1-type containing 1 (ZNFX1)
Clone Name :	eg01672 [Vector Info]
Flexi ORF Clone :	pF1KA1404
Source :
Note :	We replaced fg02672, former representative clones for KIAA1404 with eg01672. (2007/1/24)

Features of the cloned DNA sequence	Description

Length: 7184 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1362 bp

Genome contig ID gi51511747r_47195848
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TTAGCTTATAAAGCCAATTAAAAACGATGATTGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATCAGTGGTCCACGTGTATCCTCAATTTTCAGAAGCAACTCAGCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 47295848 47327981 14 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1925 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW75662	100.0	zinc finger, NF...	Homo sapiens
Q9P2E3	99.9	NFX1-type zinc ...	Homo sapiens
XP_001098884	98.4	zinc finger, NF...	Macaca mulatta
XP_001503613	90.6	similar to NFX1...	Equus caballus
XP_589621	88.8	similar to NFX1...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86988	6.6e-07	31.9	KIAA0221
D63483	1.5e-06	27.2	KIAA0149
D42046	2.6e-05	27.2	KIAA0083
AB011132	4.5e-05	32.7	KIAA0560
AB058677	0.0003	27.3	KIAA1781

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000967 1305 1327 PF01422 Zinc finger

IPR000967 1337 1353 PF01422 Zinc finger

IPR000967 1389 1407 PF01422 Zinc finger

IPR000967 1448 1470 PF01422 Zinc finger

IPR000967 1478 1495 PF01422 Zinc finger

IPR000967 1553 1571 PF01422 Zinc finger

HMMSmart IPR000967 1305 1331 SM00438 Zinc finger

IPR000967 1334 1353 SM00438 Zinc finger

IPR000967 1389 1407 SM00438 Zinc finger

IPR000967 1478 1495 SM00438 Zinc finger

IPR000967 1553 1571 SM00438 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000967	1305	1327	PF01422	Zinc finger
IPR000967	1337	1353	PF01422	Zinc finger
IPR000967	1389	1407	PF01422	Zinc finger
IPR000967	1448	1470	PF01422	Zinc finger
IPR000967	1478	1495	PF01422	Zinc finger
IPR000967	1553	1571	PF01422	Zinc finger
HMMSmart	IPR000967	1305	1331	SM00438	Zinc finger
IPR000967	1334	1353	SM00438	Zinc finger
IPR000967	1389	1407	SM00438	Zinc finger
IPR000967	1478	1495	SM00438	Zinc finger
IPR000967	1553	1571	SM00438	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1362 bp
Genome contig ID	gi51511747r_47195848
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TTAGCTTATAAAGCCAATTAAAAACGATGATTGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATCAGTGGTCCACGTGTATCCTCAATTTTCAGAAGCAACTCAGCCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	47295848	47327981	14	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1404

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information