HUGE

Gene/Protein Characteristic Table for KIAA1769

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01636
Accession No. :	AB051556
Description :	Peroxisomal proliferator-activated receptor A-interacting complex 285 kDa protein.
HUGO Gene Name :
Clone Name :	af00171 [Vector Info]
Flexi ORF Clone :	pF1KSDA1769
Source :	Human brain (amygdala)
Note :	We replaced pj00758, former representative clones for KIAA1769 with af00171. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 7484 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1137 bp

Genome contig ID gi51511747r_61559908
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTTGAATTATGTGATTAGATATTAATTTAATGAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACCACTCTGAAAGCTCTTCTCACTTCTGGGTGTTTGAGGTCTGGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 61659908 61669551 14 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 2114 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM74197	100.0	peroxisomal pro...	Homo sapiens
EAW75255	99.9	peroxisomal pro...	Homo sapiens
CAI95749	99.8	peroxisomal pro...	Homo sapiens
Q9BYK8	99.4	Peroxisomal pro...	Homo sapiens
NP_001032412	99.3	PPAR-alpha inte...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29677	8.7e-36	41.0	KIAA0054
AB075835	6.1e-18	24.6	KIAA1955
AB023225	4.8e-12	24.0	KIAA1008
AB046851	1.9e-09	26.0	KIAA1631
D42046	2.7e-05	27.2	KIAA0083

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001900 799 1158 PF00773 Ribonuclease II and R

ScanRegExp IPR001900 1125 1149 PS01175 Ribonuclease II and R

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001900	799	1158	PF00773	Ribonuclease II and R
ScanRegExp	IPR001900	1125	1149	PS01175	Ribonuclease II and R

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATGAGCGGCTGCAAAACCTG

Primer_r
: GTCTTCAGCTTGCTCTTGTAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: CCR
Primer_f	: AATGAGCGGCTGCAAAACCTG
Primer_r	: GTCTTCAGCTTGCTCTTGTAG
PCR product length	: 146(250) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1137 bp
Genome contig ID	gi51511747r_61559908
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTTGAATTATGTGATTAGATATTAATTTAATGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACCACTCTGAAAGCTCTTCTCACTTCTGGGTGTTTGAGGTCTGGCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	61659908	61669551	14	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA1769

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information