Order Kazusa clone(s) from : ![]() |
Product ID | ORK05022 |
---|---|
Accession No | AB051482 |
Description | formin homology 2 domain containing 3 |
Clone name | fj11471 |
Vector information | |
cDNA sequence | DNA sequence (4126 bp) Predicted protein sequence (1199 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1695
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 525 bp |
---|---|
Genome contig ID | gi51511735f_32328747 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (285271 - 285320) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 18 | f | 32428747 | 32614016 | 18 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR015425 | 661 | 1031 | PF02181 | Actin-binding FH2 |
HMMSmart | IPR003104 | 660 | 1105 | SM00498 | Actin-binding FH2 and DRF autoregulatory |
ProfileScan | IPR014768 | 1 | 248 | PS51232 | GTPase-binding/formin homology 3 |
IPR014767 | 1136 | 1168 | PS51231 | Diaphanous autoregulatory |
![]() |
Primer_f | TCTCTTGATTCCGTGACACCC |
---|---|
Primer_r | ATTTTGGTGTTGTGGAGACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |