Order Kazusa clone(s) from : ![]() |
Product ID | ORK00063 |
---|---|
Accession No | AB002379 |
Description | dishevelled associated activator of morphogenesis 2, transcript variant 1 |
Clone name | ah04695 |
Vector information | |
cDNA sequence | DNA sequence (6177 bp) Predicted protein sequence (1114 aa) |
HaloTag ORF Clone |
FHC00063
![]() |
Flexi ORF Clone | FXC00063 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA0381
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00540, former representative clones for KIAA0381 with ah04695. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2831 bp |
---|---|
Genome contig ID | gi89161210f_39768137 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (212487 - 212536) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 39868137 | 39980622 | 25 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010473 | 86 | 275 | PF06371 | Diaphanous GTPase-binding |
IPR010472 | 277 | 483 | PF06367 | Diaphanous FH3 | |
IPR015425 | 642 | 1015 | PF02181 | Actin-binding FH2 | |
HMMSmart | IPR003104 | 641 | 1084 | SM00498 | Actin-binding FH2 and DRF autoregulatory |
ProfileScan | IPR014768 | 86 | 462 | PS51232 | GTPase-binding/formin homology 3 |
IPR014767 | 1062 | 1094 | PS51231 | Diaphanous autoregulatory |
![]() |
---|
Primer_f | AAGGTGCAAGTGAAAAAGGAC |
---|---|
Primer_r | ATCTCCCCCGACTTCTACCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAGGTGCAAGTGAAAAAGGAC |
Primer_r | ATCTCCCCCGACTTCTACCAG |
PCR product length | 117 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |