Order Kazusa clone(s) from : ![]() |
Product ID | ORK00599 |
---|---|
Accession No | AB014566 |
Description | dishevelled associated activator of morphogenesis 1, transcript variant 1 |
Clone name | hk02075 |
Vector information | |
cDNA sequence | DNA sequence (4153 bp) Predicted protein sequence (1085 aa) |
HaloTag ORF Clone |
FHC00599
![]() |
Flexi ORF Clone | FXC00599 |
Source | Human adult brain |
Rouge ID |
mKIAA0666
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010473 | 52 | 240 | PF06371 | Diaphanous GTPase-binding |
IPR010472 | 242 | 448 | PF06367 | Diaphanous FH3 | |
IPR015425 | 608 | 991 | PF02181 | Actin-binding FH2 | |
HMMSmart | IPR003104 | 607 | 1078 | SM00498 | Actin-binding FH2 and DRF autoregulatory |
ProfileScan | IPR014768 | 52 | 427 | PS51232 | GTPase-binding/formin homology 3 |
IPR014767 | 1034 | 1065 | PS51231 | Diaphanous autoregulatory |
![]() |
---|
![]() |
Primer_f | CACATCAGTAATAGGACCAGC |
---|---|
Primer_r | GCACTTGGCAGAGATAACTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CACATCAGTAATAGGACCAGC |
Primer_r | GCACTTGGCAGAGATAACTTG |
PCR product length | 184 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |