Order Kazusa clone(s) from : ![]() |
Product ID | ORK00256 |
---|---|
Accession No | AB046841 |
Description | protocadherin beta 16 |
Clone name | hj04505 |
Vector information | |
cDNA sequence | DNA sequence (4998 bp) Predicted protein sequence (787 aa) |
HaloTag ORF Clone |
FHC00256
![]() |
Flexi ORF Clone | FXC00256 |
Source | Human adult brain |
Rouge ID |
mKIAA1621
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1510 bp |
---|---|
Genome contig ID | gi51511721f_140441164 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (104996 - 105045) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 140541164 | 140546158 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 84 | 103 | PR00205 | Cadherin |
IPR002126 | 253 | 282 | PR00205 | Cadherin | |
IPR002126 | 325 | 337 | PR00205 | Cadherin | |
IPR002126 | 337 | 356 | PR00205 | Cadherin | |
IPR002126 | 460 | 473 | PR00205 | Cadherin | |
IPR002126 | 520 | 546 | PR00205 | Cadherin | |
IPR002126 | 554 | 571 | PR00205 | Cadherin | |
HMMPfam | IPR013164 | 40 | 123 | PF08266 | Cadherin |
IPR002126 | 209 | 244 | PF00028 | Cadherin | |
IPR002126 | 258 | 349 | PF00028 | Cadherin | |
IPR002126 | 363 | 453 | PF00028 | Cadherin | |
IPR002126 | 467 | 563 | PF00028 | Cadherin | |
IPR002126 | 591 | 674 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 166 | 251 | SM00112 | Cadherin |
IPR002126 | 275 | 356 | SM00112 | Cadherin | |
IPR002126 | 379 | 460 | SM00112 | Cadherin | |
IPR002126 | 484 | 570 | SM00112 | Cadherin | |
IPR002126 | 600 | 681 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 45 | 144 | PS50268 | Cadherin |
IPR002126 | 145 | 253 | PS50268 | Cadherin | |
IPR002126 | 254 | 358 | PS50268 | Cadherin | |
IPR002126 | 359 | 462 | PS50268 | Cadherin | |
IPR002126 | 463 | 572 | PS50268 | Cadherin | |
IPR002126 | 587 | 685 | PS50268 | Cadherin | |
ScanRegExp | IPR002126 | 132 | 142 | PS00232 | Cadherin |
IPR002126 | 241 | 251 | PS00232 | Cadherin | |
IPR002126 | 346 | 356 | PS00232 | Cadherin | |
IPR002126 | 450 | 460 | PS00232 | Cadherin | |
IPR002126 | 560 | 570 | PS00232 | Cadherin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 23 | RQVLVFFVLLSLSGAGAELGSYS | 45 | SECONDARY | 23 | 2 | 700 | YLVVALASVSSLFLFSVLLFVVV | 722 | PRIMARY | 23 |
---|
![]() |
Primer_f | CGCCTGAGATAGTAGTTGCTG |
---|---|
Primer_r | AGTGCTCTCTCCGTTACCAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | CGCCTGAGATAGTAGTTGCTG |
Primer_r | AGTGCTCTCTCCGTTACCAAG |
PCR product length | 148 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |