Order Kazusa clone(s) from : ![]() |
Product ID | ORK05594 |
---|---|
Accession No | AB002343 |
Description | protocadherin alpha 9 |
Clone name | hg01491 |
Vector information | |
cDNA sequence | DNA sequence (6387 bp) Predicted protein sequence (845 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0345
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3134 bp |
---|---|
Genome contig ID | gi51511721f_140107541 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (106389 - 106438) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 140207541 | 140213928 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 76 | 95 | PR00205 | Cadherin |
IPR002126 | 245 | 274 | PR00205 | Cadherin | |
IPR002126 | 423 | 435 | PR00205 | Cadherin | |
IPR002126 | 437 | 456 | PR00205 | Cadherin | |
IPR002126 | 456 | 469 | PR00205 | Cadherin | |
IPR002126 | 516 | 542 | PR00205 | Cadherin | |
IPR002126 | 550 | 567 | PR00205 | Cadherin | |
HMMPfam | IPR013164 | 32 | 115 | PF08266 | Cadherin |
IPR002126 | 141 | 236 | PF00028 | Cadherin | |
IPR002126 | 250 | 344 | PF00028 | Cadherin | |
IPR002126 | 358 | 449 | PF00028 | Cadherin | |
IPR002126 | 463 | 559 | PF00028 | Cadherin | |
IPR002126 | 591 | 673 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 48 | 134 | SM00112 | Cadherin |
IPR002126 | 158 | 243 | SM00112 | Cadherin | |
IPR002126 | 267 | 351 | SM00112 | Cadherin | |
IPR002126 | 375 | 456 | SM00112 | Cadherin | |
IPR002126 | 480 | 566 | SM00112 | Cadherin | |
IPR002126 | 597 | 679 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 11 | 136 | PS50268 | Cadherin |
IPR002126 | 137 | 245 | PS50268 | Cadherin | |
IPR002126 | 246 | 353 | PS50268 | Cadherin | |
IPR002126 | 354 | 458 | PS50268 | Cadherin | |
IPR002126 | 459 | 568 | PS50268 | Cadherin | |
IPR002126 | 591 | 681 | PS50268 | Cadherin | |
ScanRegExp | IPR002126 | 124 | 134 | PS00232 | Cadherin |
IPR002126 | 233 | 243 | PS00232 | Cadherin | |
IPR002126 | 341 | 351 | PS00232 | Cadherin | |
IPR002126 | 446 | 456 | PS00232 | Cadherin | |
IPR002126 | 556 | 566 | PS00232 | Cadherin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 15 | QPLLLSLLILAMWVVGSGQLHYS | 37 | PRIMARY | 23 | 2 | 701 | VYLIIAICAVSSLLVLTLLLYTV | 723 | PRIMARY | 23 | 3 | 812 | IIFFLERYYRLLPGAVQIVLFIF | 834 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | TGCTCTTACTACCCATTTCAG |
---|---|
Primer_r | CGCATTAGCATTAGCAGCACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGCTCTTACTACCCATTTCAG |
Primer_r | CGCATTAGCATTAGCAGCACC |
PCR product length | 88 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |