KIAA0345

Product ID	ORK05594
Accession No	AB002343
Description	protocadherin alpha 9
Clone name	hg01491
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6387 bp) Predicted protein sequence (845 aa)
Source	Human adult brain
Rouge ID	mKIAA0345 by Kazusa Mouse cDNA Project

Length: 6387 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3134 bp
Genome contig ID	gi51511721f_140107541
PolyA signal sequence (None)	+--------+--------+----*----+---- GCATTTCAGCCCGGGTGACAGCGAGATTCTGTCTC
Flanking genome sequence (106389 - 106438)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGAGTAGTTTAACTACTCCCTACTTTTTATTCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	140207541	140213928	1	99.0	Perfect prediction

Length: 845 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW62007	99.6	hCG1982192, iso...	Homo sapiens
Q9Y5H5	100.0	Protocadherin a...	Homo sapiens
EAW61994	99.6	hCG1982192, iso...	Homo sapiens
Q5DRE3	99.0	Protocadherin a...	Pan troglodytes
XP_001088201	95.1	protocadherin a...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011160	3.7e-113	41.5	KIAA0588
AB002325	4.5e-110	43.6	KIAA0327
AB046841	2.5e-105	41.0	KIAA1621
AB046782	3e-89	34.5	KIAA1562
AB037821	2.6e-76	41.9	KIAA1400

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	76	95	PR00205	Cadherin
	IPR002126	245	274	PR00205	Cadherin
	IPR002126	423	435	PR00205	Cadherin
	IPR002126	437	456	PR00205	Cadherin
	IPR002126	456	469	PR00205	Cadherin
	IPR002126	516	542	PR00205	Cadherin
	IPR002126	550	567	PR00205	Cadherin
HMMPfam	IPR013164	32	115	PF08266	Cadherin
	IPR002126	141	236	PF00028	Cadherin
	IPR002126	250	344	PF00028	Cadherin
	IPR002126	358	449	PF00028	Cadherin
	IPR002126	463	559	PF00028	Cadherin
	IPR002126	591	673	PF00028	Cadherin
HMMSmart	IPR002126	48	134	SM00112	Cadherin
	IPR002126	158	243	SM00112	Cadherin
	IPR002126	267	351	SM00112	Cadherin
	IPR002126	375	456	SM00112	Cadherin
	IPR002126	480	566	SM00112	Cadherin
	IPR002126	597	679	SM00112	Cadherin
ProfileScan	IPR002126	11	136	PS50268	Cadherin
	IPR002126	137	245	PS50268	Cadherin
	IPR002126	246	353	PS50268	Cadherin
	IPR002126	354	458	PS50268	Cadherin
	IPR002126	459	568	PS50268	Cadherin
	IPR002126	591	681	PS50268	Cadherin
ScanRegExp	IPR002126	124	134	PS00232	Cadherin
	IPR002126	233	243	PS00232	Cadherin
	IPR002126	341	351	PS00232	Cadherin
	IPR002126	446	456	PS00232	Cadherin
	IPR002126	556	566	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	15	QPLLLSLLILAMWVVGSGQLHYS	37	PRIMARY	23
	2	701	VYLIIAICAVSSLLVLTLLLYTV	723	PRIMARY	23
	3	812	IIFFLERYYRLLPGAVQIVLFIF	834	PRIMARY	23

Primer_f	TGCTCTTACTACCCATTTCAG
Primer_r	CGCATTAGCATTAGCAGCACC
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TGCTCTTACTACCCATTTCAG
Primer_r	CGCATTAGCATTAGCAGCACC
PCR product length	88 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles