Order Kazusa clone(s) from : ![]() |
Product ID | ORK00569 |
---|---|
Accession No | AB011160 |
Description | protocadherin gamma subfamily A, 12, transcript variant 1 |
Clone name | hj02685 |
Vector information | |
cDNA sequence | DNA sequence (4747 bp) Predicted protein sequence (938 aa) |
HaloTag ORF Clone |
FHC00569
![]() |
Flexi ORF Clone | FXC00569 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 79 | 98 | PR00205 | Cadherin |
IPR002126 | 248 | 277 | PR00205 | Cadherin | |
IPR002126 | 320 | 332 | PR00205 | Cadherin | |
IPR002126 | 332 | 351 | PR00205 | Cadherin | |
IPR002126 | 456 | 469 | PR00205 | Cadherin | |
IPR002126 | 516 | 542 | PR00205 | Cadherin | |
IPR002126 | 550 | 567 | PR00205 | Cadherin | |
HMMPfam | IPR013164 | 35 | 118 | PF08266 | Cadherin |
IPR002126 | 144 | 239 | PF00028 | Cadherin | |
IPR002126 | 253 | 344 | PF00028 | Cadherin | |
IPR002126 | 358 | 449 | PF00028 | Cadherin | |
IPR002126 | 463 | 559 | PF00028 | Cadherin | |
IPR002126 | 588 | 671 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 51 | 137 | SM00112 | Cadherin |
IPR002126 | 161 | 246 | SM00112 | Cadherin | |
IPR002126 | 270 | 351 | SM00112 | Cadherin | |
IPR002126 | 375 | 456 | SM00112 | Cadherin | |
IPR002126 | 480 | 566 | SM00112 | Cadherin | |
IPR002126 | 597 | 675 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 81 | 139 | PS50268 | Cadherin |
IPR002126 | 140 | 248 | PS50268 | Cadherin | |
IPR002126 | 249 | 353 | PS50268 | Cadherin | |
IPR002126 | 354 | 458 | PS50268 | Cadherin | |
IPR002126 | 459 | 568 | PS50268 | Cadherin | |
IPR002126 | 585 | 689 | PS50268 | Cadherin | |
ScanRegExp | IPR002126 | 127 | 137 | PS00232 | Cadherin |
IPR002126 | 236 | 246 | PS00232 | Cadherin | |
IPR002126 | 341 | 351 | PS00232 | Cadherin | |
IPR002126 | 446 | 456 | PS00232 | Cadherin | |
IPR002126 | 556 | 566 | PS00232 | Cadherin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 13 | HRDYKGLVLLGILLGTLWETGCT | 35 | SECONDARY | 23 | 2 | 697 | LYLVVAVAAVSCVFLAFVILLLA | 719 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | CCTCCTTGTGCATAGACCTTC |
---|---|
Primer_r | GCACACCGCACTACACTACTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCTCCTTGTGCATAGACCTTC |
Primer_r | GCACACCGCACTACACTACTG |
PCR product length | 161 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |