Order Kazusa clone(s) from : ![]() |
Product ID | ORK01696 |
---|---|
Accession No | AB053446 |
Description | dachsous cadherin-related 1 |
Clone name | hj00752s2 |
Vector information | |
cDNA sequence | DNA sequence (10759 bp) Predicted protein sequence (3434 aa) |
HaloTag ORF Clone |
FHC01696
![]() |
Flexi ORF Clone | FXC01696 |
Source | Human adult brain |
Note | We replaced hj00752x1, former representative clones for KIAA1773 with hj00752s2. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 452 bp |
---|---|
Genome contig ID | gi51511727r_6499134 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 6599134 | 6633661 | 21 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 226 | 245 | PR00205 | Cadherin |
IPR002126 | 391 | 420 | PR00205 | Cadherin | |
IPR002126 | 463 | 475 | PR00205 | Cadherin | |
IPR002126 | 693 | 712 | PR00205 | Cadherin | |
IPR002126 | 924 | 937 | PR00205 | Cadherin | |
IPR002126 | 1186 | 1212 | PR00205 | Cadherin | |
IPR002126 | 1223 | 1240 | PR00205 | Cadherin | |
HMMPfam | IPR002126 | 183 | 270 | PF00028 | Cadherin |
IPR002126 | 303 | 382 | PF00028 | Cadherin | |
IPR002126 | 396 | 489 | PF00028 | Cadherin | |
IPR002126 | 510 | 599 | PF00028 | Cadherin | |
IPR002126 | 614 | 705 | PF00028 | Cadherin | |
IPR002126 | 719 | 812 | PF00028 | Cadherin | |
IPR002126 | 826 | 917 | PF00028 | Cadherin | |
IPR002126 | 931 | 1021 | PF00028 | Cadherin | |
IPR002126 | 1035 | 1125 | PF00028 | Cadherin | |
IPR002126 | 1141 | 1232 | PF00028 | Cadherin | |
IPR002126 | 1246 | 1338 | PF00028 | Cadherin | |
IPR002126 | 1358 | 1448 | PF00028 | Cadherin | |
IPR002126 | 1473 | 1563 | PF00028 | Cadherin | |
IPR002126 | 1577 | 1673 | PF00028 | Cadherin | |
IPR002126 | 1686 | 1776 | PF00028 | Cadherin | |
IPR002126 | 1790 | 1878 | PF00028 | Cadherin | |
IPR002126 | 1892 | 1982 | PF00028 | Cadherin | |
IPR002126 | 1996 | 2087 | PF00028 | Cadherin | |
IPR002126 | 2119 | 2195 | PF00028 | Cadherin | |
IPR002126 | 2209 | 2298 | PF00028 | Cadherin | |
IPR002126 | 2312 | 2404 | PF00028 | Cadherin | |
IPR002126 | 2417 | 2503 | PF00028 | Cadherin | |
IPR002126 | 2517 | 2609 | PF00028 | Cadherin | |
IPR002126 | 2623 | 2729 | PF00028 | Cadherin | |
IPR002126 | 2743 | 2833 | PF00028 | Cadherin | |
IPR002126 | 2847 | 2940 | PF00028 | Cadherin | |
IPR002126 | 2954 | 3007 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 200 | 277 | SM00112 | Cadherin |
IPR002126 | 301 | 389 | SM00112 | Cadherin | |
IPR002126 | 413 | 496 | SM00112 | Cadherin | |
IPR002126 | 524 | 606 | SM00112 | Cadherin | |
IPR002126 | 631 | 712 | SM00112 | Cadherin | |
IPR002126 | 736 | 819 | SM00112 | Cadherin | |
IPR002126 | 843 | 924 | SM00112 | Cadherin | |
IPR002126 | 948 | 1028 | SM00112 | Cadherin | |
IPR002126 | 1052 | 1132 | SM00112 | Cadherin | |
IPR002126 | 1158 | 1239 | SM00112 | Cadherin | |
IPR002126 | 1263 | 1345 | SM00112 | Cadherin | |
IPR002126 | 1375 | 1455 | SM00112 | Cadherin | |
IPR002126 | 1487 | 1570 | SM00112 | Cadherin | |
IPR002126 | 1594 | 1680 | SM00112 | Cadherin | |
IPR002126 | 1703 | 1783 | SM00112 | Cadherin | |
IPR002126 | 1807 | 1885 | SM00112 | Cadherin | |
IPR002126 | 1908 | 1989 | SM00112 | Cadherin | |
IPR002126 | 2013 | 2094 | SM00112 | Cadherin | |
IPR002126 | 2122 | 2202 | SM00112 | Cadherin | |
IPR002126 | 2226 | 2305 | SM00112 | Cadherin | |
IPR002126 | 2329 | 2411 | SM00112 | Cadherin | |
IPR002126 | 2434 | 2510 | SM00112 | Cadherin | |
IPR002126 | 2534 | 2616 | SM00112 | Cadherin | |
IPR002126 | 2640 | 2736 | SM00112 | Cadherin | |
IPR002126 | 2760 | 2840 | SM00112 | Cadherin | |
IPR002126 | 2864 | 2947 | SM00112 | Cadherin | |
IPR002126 | 2971 | 3062 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 179 | 279 | PS50268 | Cadherin |
IPR002126 | 280 | 391 | PS50268 | Cadherin | |
IPR002126 | 392 | 498 | PS50268 | Cadherin | |
IPR002126 | 510 | 608 | PS50268 | Cadherin | |
IPR002126 | 618 | 714 | PS50268 | Cadherin | |
IPR002126 | 715 | 821 | PS50268 | Cadherin | |
IPR002126 | 822 | 926 | PS50268 | Cadherin | |
IPR002126 | 927 | 1030 | PS50268 | Cadherin | |
IPR002126 | 1031 | 1136 | PS50268 | Cadherin | |
IPR002126 | 1137 | 1247 | PS50268 | Cadherin | |
IPR002126 | 1242 | 1347 | PS50268 | Cadherin | |
IPR002126 | 1360 | 1460 | PS50268 | Cadherin | |
IPR002126 | 1469 | 1572 | PS50268 | Cadherin | |
IPR002126 | 1573 | 1682 | PS50268 | Cadherin | |
IPR002126 | 1682 | 1785 | PS50268 | Cadherin | |
IPR002126 | 1786 | 1887 | PS50268 | Cadherin | |
IPR002126 | 1888 | 1991 | PS50268 | Cadherin | |
IPR002126 | 1992 | 2096 | PS50268 | Cadherin | |
IPR002126 | 2119 | 2204 | PS50268 | Cadherin | |
IPR002126 | 2205 | 2307 | PS50268 | Cadherin | |
IPR002126 | 2308 | 2413 | PS50268 | Cadherin | |
IPR002126 | 2413 | 2512 | PS50268 | Cadherin | |
IPR002126 | 2513 | 2618 | PS50268 | Cadherin | |
IPR002126 | 2619 | 2738 | PS50268 | Cadherin | |
IPR002126 | 2739 | 2842 | PS50268 | Cadherin | |
IPR002126 | 2843 | 2949 | PS50268 | Cadherin | |
IPR002126 | 2950 | 3069 | PS50268 | Cadherin | |
ScanRegExp | IPR002126 | 267 | 277 | PS00232 | Cadherin |
IPR002126 | 379 | 389 | PS00232 | Cadherin | |
IPR002126 | 486 | 496 | PS00232 | Cadherin | |
IPR002126 | 596 | 606 | PS00232 | Cadherin | |
IPR002126 | 702 | 712 | PS00232 | Cadherin | |
IPR002126 | 809 | 819 | PS00232 | Cadherin | |
IPR002126 | 1018 | 1028 | PS00232 | Cadherin | |
IPR002126 | 1335 | 1345 | PS00232 | Cadherin | |
IPR002126 | 1670 | 1680 | PS00232 | Cadherin | |
IPR002126 | 1875 | 1885 | PS00232 | Cadherin | |
IPR002126 | 1979 | 1989 | PS00232 | Cadherin | |
IPR002126 | 2084 | 2094 | PS00232 | Cadherin | |
IPR002126 | 2295 | 2305 | PS00232 | Cadherin | |
IPR002126 | 2401 | 2411 | PS00232 | Cadherin | |
IPR002126 | 2500 | 2510 | PS00232 | Cadherin | |
IPR002126 | 2606 | 2616 | PS00232 | Cadherin | |
IPR002126 | 2726 | 2736 | PS00232 | Cadherin | |
IPR002126 | 2830 | 2840 | PS00232 | Cadherin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 154 | RPHLLLPLLLLLLLLLGAGVPGA | 176 | PRIMARY | 23 | 2 | 199 | DISAGLPAGTAAPLMYFISAQE | 220 | SECONDARY | 22 | 3 | 3074 | VGAVAASLGVVVVLALAALVLGL | 3096 | PRIMARY | 23 |
---|
![]() |
Primer_f | ACCCTGAGATGGAGCTGAGAC |
---|---|
Primer_r | CAGTTTATTAAGGCTCCAGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCTGTGGAGGATGAGAATGAC |
Primer_r | CGAAGCATGGTAAGGGTCTGG |
PCR product length | 101 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |