Order Kazusa clone(s) from : ![]() |
Product ID | ORK04799 |
---|---|
Accession No | AB051484 |
Description | dynein, axonemal, heavy chain 6 |
Clone name | fj14406y2 |
Vector information | |
cDNA sequence | DNA sequence (6721 bp) Predicted protein sequence (2182 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1697
by Kazusa Mouse cDNA Project
|
Note | We replaced fj14406, former representative clones for KIAA1697 with fj14406y2. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 172 bp |
---|---|
Genome contig ID | gi89161199f_84639660 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (260557 - 260606) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 84739654 | 84900215 | 41 | 99.9 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | TATTTTGCACCCATGGCTGAC |
---|---|
Primer_r | GTAGATGACCTTGGCTGAACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | TATTTTGCACCCATGGCTGAC |
Primer_r | GTAGATGACCTTGGCTGAACC |
PCR product length | 176 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |