KIAA1090

Product ID	ORK07365
Accession No	AB029013
Description	Wolf-Hirschhorn syndrome candidate 1
Clone name	hk03921a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2670 bp) Predicted protein sequence (715 aa)
Source	Human adult brain
Rouge ID	mKIAA1090 by Kazusa Mouse cDNA Project

Length: 2670 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	6 bp
Genome contig ID	gi89161207f_1823630
PolyA signal sequence (None)	+--------+--------+----*----+---- GCTGGCGGAGAGTCACAGAGGGCAAATAGCGCCAG
Flanking genome sequence (126812 - 126861)	----+--------+--------+--------+--------+----* GCGGCCGCTTGGCCGGATCCAGGGGCGGTGCAGGGCGGCCGGCCCTGCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	1923627	1950440	12	99.6	Perfect prediction

Length: 715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52413	100.0	WHSC1 protein [...	Homo sapiens
CAM15220	99.9	Wolf-Hirschhorn...	Homo sapiens
XP_001145170	99.9	Wolf-Hirschhorn...	Pan troglodytes
EAW82551	97.5	Wolf-Hirschhorn...	Homo sapiens
O96028	97.5	Probable histon...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051519	1.2e-29	40.3	KIAA1732
AB002386	3.1e-12	32.5	KIAA0388
AB028999	4.2e-10	34.8	KIAA1076
AB002337	2.4e-08	35.2	KIAA0339
AB002302	3.7e-08	35.8	KIAA0304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	183	225	PF00628	Zinc finger
	IPR000313	227	301	PF00855	PWWP
	IPR001214	407	536	PF00856	SET
	IPR001965	591	638	PF00628	Zinc finger
HMMSmart	IPR001965	66	113	SM00249	Zinc finger
	IPR001965	183	223	SM00249	Zinc finger
	IPR000313	228	290	SM00293	PWWP
	IPR006560	361	412	SM00570	AWS
	IPR001214	413	536	SM00317	SET
	IPR003616	537	553	SM00508	Post-SET zinc-binding region
	IPR001965	591	634	SM00249	Zinc finger
ProfileScan	IPR001841	67	113	PS50089	Zinc finger
	IPR001965	181	225	PS50016	Zinc finger
	IPR000313	230	292	PS50812	PWWP
	IPR006560	361	411	PS51215	AWS
	IPR001214	412	534	PS50280	SET
	IPR003616	537	553	PS50868	Post-SET zinc-binding region
ScanRegExp	IPR001965	184	222	PS01359	Zinc finger

Primer_f	CCCAATTCGTTCTGTAAGGAG
Primer_r	GCTATTTGCCCTCTGTGACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCAATTCGTTCTGTAAGGAG
Primer_r	GCTATTTGCCCTCTGTGACTC
PCR product length	202 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles