KIAA0304

Product ID	ORK07348
Accession No	AB002302
Description	lysine (K)-specific methyltransferase 2B
Clone name	af07172
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7568 bp) Predicted protein sequence (2415 aa)
Source	Human brain (amygdala)
Rouge ID	mKIAA0304 by Kazusa Mouse cDNA Project
Note	We replaced hg00016, former representative clones for KIAA0304 with af07172. (2005/08/06)

Length: 7568 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	320 bp
Genome contig ID	gi42406306f_40802990
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GGAACCCCCCCACAATAAAGTCTGTCAATGTTTGG
Flanking genome sequence (118630 - 118679)	----+--------+--------+--------+--------+----* AGAGGTGGTCTTCCCATTTGTAGGCTGTGGGGGCAGGTAGGAACCCCACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	40902990	40921618	35	100.0	Perfect prediction

Length: 2415 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAD56420	100.0	MLL2 protein [H...	Homo sapiens
Q9UMN6	100.0	Histone-lysine ...	Homo sapiens
XP_512597	99.4	myeloid/lymphoi...	Pan troglodytes
XP_341830	90.0	similar to WW d...	Rattus norvegicus
EDM07733	91.3	rCG63528 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028999	1.4e-07	29.3	KIAA1076
AB002337	3.3e-06	26.4	KIAA0339
AB051468	2.8e-05	27.0	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002857	659	705	PF02008	Zinc finger
	IPR001965	903	952	PF00628	Zinc finger
	IPR001965	953	1003	PF00628	Zinc finger
	IPR001965	1037	1096	PF00628	Zinc finger
	IPR003888	1432	1482	PF05964	FY-rich
	IPR003889	2111	2194	PF05965	FY-rich
	IPR001214	2269	2397	PF00856	SET
HMMSmart	IPR001965	903	950	SM00249	Zinc finger
	IPR001965	951	1001	SM00249	Zinc finger
	IPR001965	1037	1094	SM00249	Zinc finger
	IPR001965	1340	1386	SM00249	Zinc finger
	IPR003888	1439	1482	SM00541	FY-rich
	IPR003889	2113	2198	SM00542	FY-rich
	IPR001214	2275	2397	SM00317	SET
	IPR003616	2399	2415	SM00508	Post-SET zinc-binding region
ProfileScan	IPR002857	659	706	PS51058	Zinc finger
	IPR001965	901	952	PS50016	Zinc finger
	IPR001965	949	1003	PS50016	Zinc finger
	IPR001965	1035	1096	PS50016	Zinc finger
	IPR001214	2274	2395	PS50280	SET
	IPR003616	2399	2415	PS50868	Post-SET zinc-binding region
ScanRegExp	IPR001965	904	971	PS01359	Zinc finger
ScanRegExp	IPR001965	1025	1093	PS01359	Zinc finger

Primer_f	ACTTTATTGTGGGGGGGTTCC
Primer_r	ATGTTCAGGGTGGATGTGGGC
PCR conditions	95 °C15 sec68 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACTTTATTGTGGGGGGGTTCC
Primer_r	ATGTTCAGGGTGGATGTGGGC
PCR product length	196 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles