ROUGE |
Gene/Protein Characteristic Table for mKIAA1090 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129287 |
---|---|
IL-5 promoter REII-region-binding protein homolog. | |
mph00524 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3381 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 316 bp Genome contig ID gi65498774f_32243627 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
ATTTCTATTTTAGATTAAAGTTATGATTGAAGATTFlanking genome sequence
(140132 - 140181) ----+----*----+----*----+----*----+----*----+----*
AACTGGCATGTGAAATGCTTTTATCTTACCTGAAACAAAGAATTTTCTAA
KIAA Alignment based on: KIAA1090 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 492..3065
Length: 857 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |