KIAA0949

Product ID	ORK00156
Accession No	AB023166
Description	citron rho-interacting serine/threonine kinase
Clone name	af07325
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone af07325 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (8516 bp) Predicted protein sequence (1559 aa)
HaloTag ORF Clone	FHC00156
Flexi ORF Clone	FXC00156
Source	Human brain (amygdala)
Note	We replaced hj05069, former representative clones for KIAA0949 with af07325. (1999/6/16)

Length: 8516 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2438 bp
Genome contig ID	gi89161190r_118507981
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAACAATTAGTGAAATAAAGCAATGATCTAAACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTGTGCTTTAGTGCAATGACCTCTTCTTTTTTTGAGAGACTGTGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	118607981	118726665	39	99.7	Perfect prediction

Length: 1559 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10406	100.0	citron Rho-inte...	synthetic construct
XP_001158885	99.9	citron isoform ...	Pan troglodytes
EAW98156	99.9	citron (rho-int...	Homo sapiens
AAC27933	98.3	Citron-K kinase...	Mus musculus
EDL19840	98.3	citron, isoform...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029004	1.8e-06	23.4	KIAA1081
AB037740	1.2e-05	24.0	KIAA1319
AB040945	8.4e-05	24.7	KIAA1512
AB111886	0.00011	22.7	KIAA2034
AB002371	0.00022	23.8	KIAA0373

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	896	947	PF00130	Protein kinase C
	IPR001849	977	1096	PF00169	Pleckstrin-like
	IPR001180	1126	1416	PF00780	Citron-like
HMMSmart	IPR002219	896	944	SM00109	Protein kinase C
	IPR001849	977	1098	SM00233	Pleckstrin-like
	IPR001180	1125	1422	SM00036	Citron-like
ProfileScan	IPR002219	895	944	PS50081	Protein kinase C
ProfileScan	IPR001849	976	1096	PS50003	Pleckstrin-like
ScanRegExp	IPR005479	678	685	PS00867	Carbamoyl-phosphate synthase L chain
ScanRegExp	IPR002219	896	944	PS00479	Protein kinase C

Primer_f	CTTCCTGCTCGTGTCTTAACC
Primer_r	AAATACTGTGGACCAAGAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-