Order Kazusa clone(s) from : ![]() |
Product ID | ORK00176 |
---|---|
Accession No | AB029004 |
Description | ELKS/RAB6-interacting/CAST family member 1 |
Clone name | bg00262 |
Vector information | |
cDNA sequence | DNA sequence (6768 bp) Predicted protein sequence (1003 aa) |
HaloTag ORF Clone |
FHC00176
![]() |
Flexi ORF Clone | FXC00176 |
Source | Human adult brain |
Rouge ID |
mKIAA1081
by Kazusa Mouse cDNA Project
|
Note | We replaced hj07146, former representative clones for KIAA1081 with bg00262. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 3666 bp |
---|---|
Genome contig ID | gi89161190f_907208 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (565752 - 565801) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 1007208 | 1472958 | 18 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CTTAACCAAATGTCCCACTCC |
---|---|
Primer_r | ACTAGACTTGCCGATGGAGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTAACCAAATGTCCCACTCC |
Primer_r | ACTAGACTTGCCGATGGAGGG |
PCR product length | 170 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |