Order Kazusa clone(s) from : ![]() |
Product ID | ORK06072 |
---|---|
Accession No | AB040945 |
Description | myosin, heavy chain 7B, cardiac muscle, beta |
Clone name | fg04660y1 |
Vector information | |
cDNA sequence | DNA sequence (6289 bp) Predicted protein sequence (2010 aa) |
HaloTag ORF Clone |
FHC06072
![]() |
Flexi ORF Clone | FXC06072 |
Source | Human fetal brain |
Note | We replaced fg04660, former representative clones for KIAA1512 with fg04660y1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 245 bp |
---|---|
Genome contig ID | gi51511747f_32929096 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (124803 - 124852) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | f | 33026867 | 33053897 | 43 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001609 | 289 | 319 | PD000355 | Myosin head |
FPrintScan | IPR001609 | 183 | 202 | PR00193 | Myosin head |
IPR001609 | 239 | 264 | PR00193 | Myosin head | |
IPR001609 | 297 | 324 | PR00193 | Myosin head | |
IPR001609 | 528 | 556 | PR00193 | Myosin head | |
IPR001609 | 582 | 610 | PR00193 | Myosin head | |
HMMPfam | IPR004009 | 101 | 143 | PF02736 | Myosin |
IPR001609 | 155 | 842 | PF00063 | Myosin head | |
IPR000048 | 858 | 878 | PF00612 | IQ calmodulin-binding region | |
IPR002928 | 1144 | 2002 | PF01576 | Myosin tail | |
HMMSmart | IPR001609 | 147 | 855 | SM00242 | Myosin head |
ProfileScan | IPR000048 | 857 | 886 | PS50096 | IQ calmodulin-binding region |
ScanRegExp | IPR000169 | 404 | 414 | PS00639 | Peptidase |
![]() |
Primer_f | CCACGAGGAGGCACTTGAAGC |
---|---|
Primer_r | AGCCTGGATCTCACTCTTCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCCTCAACCTTCTGCATTCGC |
Primer_r | GTCTTCTTCATCCGTTCCAGG |
PCR product length | 220(370) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |