Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK05601 |
|---|---|
| Accession No | AB007923 |
| Description | phosphodiesterase 4D interacting protein |
| Clone name | bf02274 |
| Vector information |
The cDNA fragment was inserted at the XhoI-SacI site of the ...
|
| cDNA sequence | DNA sequence (8018 bp) Predicted protein sequence (2296 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0454
by Kazusa Mouse cDNA Project
|
| Note | We replaced hg00502, former representative clones for KIAA0454 with bf02274. (2002/5/10) |
Length: 8018 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1030 bp |
|---|---|
| Genome contig ID | gi89161185r_143462785 |
| PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | r | 143562785 | 143751231 | 46 | 99.7 | Perfect prediction |
Length: 2296 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C sec °C sec cycles |
Chromosome No. 1 Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | AAACACATTCTACCAGCACTG |
| Primer_r | CTTATCTCGGGGAAATTGCAG |
| PCR product length | 153 bp |
| PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |
Japan
||
Other countries
