KIAA0445

Product ID	ORK04634
Accession No	AB007914
Description	ciliary rootlet coiled-coil, rootletin
Clone name	hg00102s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6281 bp) Predicted protein sequence (1919 aa)
Source	Human adult brain
Rouge ID	mKIAA0445 by Kazusa Mouse cDNA Project
Note	We replaced hg00102, former representative clones for KIAA0445 with hg00102s1. (2003/4/2)

Length: 6281 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	519 bp
Genome contig ID	gi89161185f_17023503
PolyA signal sequence (None)	+--------+--------+----*----+---- CTGTTTTTTGTAACAAAACCTTGTTTTTAAAAAAG
Flanking genome sequence (148546 - 148595)	----+--------+--------+--------+--------+----* TTTGTACAGCTGTGTCCCTTTTCTAGACAATTGGAGGAGACGTCGGGGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	17123503	17172047	35	99.8	Perfect prediction

Length: 1919 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5TZA2	100.0	Rootletin; Cili...	Homo sapiens
DAA05505	100.0	TPA_exp: rootle...	Homo sapiens
XP_513109	99.1	ciliary rootlet...	Pan troglodytes
CAH70057	97.7	ciliary rootlet...	Homo sapiens
Q8CJ40	83.6	Rootletin; Cili...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067509	4.4e-30	91.7	KIAA1922
AB020673	8.3e-11	24.3	KIAA0866
AB040945	8.4e-09	25.6	KIAA1512
AB111886	3.2e-08	25.7	KIAA2034
AB051536	1.7e-06	26.6	KIAA1749

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	CTGAGCACTCTGAGGAATTTC
Primer_r	GCATGGGATCGTGGGAAAGAG
PCR product length	135 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles