Gene/Protein Characteristic Table for KIAA0866
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01129
Accession No AB020673
Description myosin, heavy chain 11, smooth muscle
Clone name hk00546s1
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
ORF sequence DNA sequence (6846 bp)
Protein sequence (1984 aa)
Flexi ORF Clone FXC01129
Source Human adult brain
Rouge ID mKIAA0866 by Kazusa Mouse cDNA Project
Note We replaced hk06733, former representative clones for KIAA0866 with hk00546s1. (2002/12/27)
Features of the cloned cDNA sequence
Description

Length: 6846 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 852 bp
Genome contig ID gi51511732r_15604497
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TTAAAAACACTTTCACTAATAAATGGTTATAAATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAATGTCGTTGGCTTTTCTGTTGAGCTGTTTTCTATAGAGGAAAAGGAG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 r 15704497 15858356 41 100.0 Perfect prediction
Features of the protein sequence
Description

Length: 1984 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P35749 0 100.0 Myosin-11; Myos...
Homo sapiens
AAS98910 0 99.6 smooth muscle m...
Homo sapiens
EAW53927 0 99.8 myosin, heavy p...
Homo sapiens
XP_850764 0 97.9 similar to smoo...
Canis lupus fam...
XP_862820 0 97.7 similar to smoo...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB111886 1.6e-108 59.8 KIAA2034
AB040945 3.3e-99 40.4 KIAA1512
AB023217 2.8e-74 37.1 KIAA1000
AB032945 2.4e-41 28.0 KIAA1119
AB018270 2.4e-25 35.8 KIAA0727
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001609 227 262 PD000355 Myosin head
FPrintScan IPR001609 127 146 PR00193 Myosin head
IPR001609 183 208 PR00193 Myosin head
IPR001609 235 262 PR00193 Myosin head
IPR001609 466 494 PR00193 Myosin head
IPR001609 520 548 PR00193 Myosin head
HMMPfam IPR004009 45 87 PF02736 Myosin
IPR001609 99 783 PF00063 Myosin head
IPR000048 799 819 PF00612 IQ calmodulin-binding region
IPR002928 1085 1942 PF01576 Myosin tail
HMMSmart IPR001609 91 796 SM00242 Myosin head
IPR000048 797 819 SM00015 IQ calmodulin-binding region
ProfileScan IPR000048 798 827 PS50096 IQ calmodulin-binding region
Expression profile
Description

RT-PCR-ELISA

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name GeneBridge 4
Primer_f CACCTCAGACACGCACAGTTC
Primer_r GTCAGGGTGTAAACAGTGCAG
PCR product length 110 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp