|
Order Kazusa clone(s) from : |
| Product ID | ORK01129 |
|---|---|
| Accession No | AB020673 |
| Description | myosin, heavy chain 11, smooth muscle |
| Clone name | hk00546s1 |
| Vector information | |
| ORF sequence | DNA sequence (6846 bp) Protein sequence (1984 aa) |
|
HaloTag ORF Clone |
FHC01129
|
| Flexi ORF Clone | FXC01129 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0866
by Kazusa Mouse cDNA Project
|
| Note | We replaced hk06733, former representative clones for KIAA0866 with hk00546s1. (2002/12/27) |
Length: 6846 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 852 bp |
|---|---|
| Genome contig ID | gi51511732r_15604497 |
| PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 16 | r | 15704497 | 15858356 | 41 | 100.0 | Perfect prediction |
Length: 1984 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| BlastProDom | IPR001609 | 227 | 262 | PD000355 | Myosin head |
| FPrintScan | IPR001609 | 127 | 146 | PR00193 | Myosin head |
| IPR001609 | 183 | 208 | PR00193 | Myosin head | |
| IPR001609 | 235 | 262 | PR00193 | Myosin head | |
| IPR001609 | 466 | 494 | PR00193 | Myosin head | |
| IPR001609 | 520 | 548 | PR00193 | Myosin head | |
| HMMPfam | IPR004009 | 45 | 87 | PF02736 | Myosin |
| IPR001609 | 99 | 783 | PF00063 | Myosin head | |
| IPR000048 | 799 | 819 | PF00612 | IQ calmodulin-binding region | |
| IPR002928 | 1085 | 1942 | PF01576 | Myosin tail | |
| HMMSmart | IPR001609 | 91 | 796 | SM00242 | Myosin head |
| IPR000048 | 797 | 819 | SM00015 | IQ calmodulin-binding region | |
| ProfileScan | IPR000048 | 798 | 827 | PS50096 | IQ calmodulin-binding region |
RT-PCR-ELISA
|
Chromosome No. 16
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | CACCTCAGACACGCACAGTTC |
| Primer_r | GTCAGGGTGTAAACAGTGCAG |
| PCR product length | 110 bp |
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |