Order Kazusa clone(s) from : ![]() |
Product ID | ORK01129 |
---|---|
Accession No | AB020673 |
Description | myosin, heavy chain 11, smooth muscle, transcript variant SM1A |
Clone name | hk00546s1 |
Vector information | |
cDNA sequence | DNA sequence (6846 bp) Predicted protein sequence (1984 aa) |
HaloTag ORF Clone |
FHC01129
![]() |
Flexi ORF Clone | FXC01129 |
Source | Human adult brain |
Rouge ID |
mKIAA0866
by Kazusa Mouse cDNA Project
|
Note | We replaced hk06733, former representative clones for KIAA0866 with hk00546s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 852 bp |
---|---|
Genome contig ID | gi51511732r_15604497 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 15704497 | 15858356 | 41 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001609 | 227 | 262 | PD000355 | Myosin head |
FPrintScan | IPR001609 | 127 | 146 | PR00193 | Myosin head |
IPR001609 | 183 | 208 | PR00193 | Myosin head | |
IPR001609 | 235 | 262 | PR00193 | Myosin head | |
IPR001609 | 466 | 494 | PR00193 | Myosin head | |
IPR001609 | 520 | 548 | PR00193 | Myosin head | |
HMMPfam | IPR004009 | 45 | 87 | PF02736 | Myosin |
IPR001609 | 99 | 783 | PF00063 | Myosin head | |
IPR000048 | 799 | 819 | PF00612 | IQ calmodulin-binding region | |
IPR002928 | 1085 | 1942 | PF01576 | Myosin tail | |
HMMSmart | IPR001609 | 91 | 796 | SM00242 | Myosin head |
IPR000048 | 797 | 819 | SM00015 | IQ calmodulin-binding region | |
ProfileScan | IPR000048 | 798 | 827 | PS50096 | IQ calmodulin-binding region |
![]() |
Primer_f | CACCTCAGACACGCACAGTTC |
---|---|
Primer_r | GTCAGGGTGTAAACAGTGCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CACCTCAGACACGCACAGTTC |
Primer_r | GTCAGGGTGTAAACAGTGCAG |
PCR product length | 110 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |