KIAA0357

Product ID	ORK04800
Accession No	AB002355
Description	dynein, axonemal, heavy chain 9
Clone name	hh00016y2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (9198 bp) Predicted protein sequence (2992 aa)
Source	Human adult brain
Rouge ID	mKIAA0357 by Kazusa Mouse cDNA Project
Note	We replaced hh00016, former representative clones for KIAA0357 with hh00016y2. (2003/8/28)

Length: 9198 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	219 bp
Genome contig ID	gi51511734f_11434119
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GGGCCCAGGTTTCTTAATAAAATGATTTACTCTTC
Flanking genome sequence (379671 - 379720)	----+--------+--------+--------+--------+----* AACTGTGTCTGGCCCAGGATTTGAGAGCTGCTGAATCATAAATGATCATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	11534119	11813788	49	99.9	Perfect prediction

Length: 2992 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06712	100.0	DNAH9 variant p...	Homo sapiens
AAI53884	100.0	DNAH9 protein [...	Homo sapiens
EAW89980	99.9	dynein, axonema...	Homo sapiens
NP_001363	97.5	dynein, axonema...	Homo sapiens
Q9NYC9	97.5	Dynein heavy ch...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040936	0	37.2	KIAA1503
AB051484	9.9e-160	32.4	KIAA1697
AB095937	1.5e-135	37.8	KIAA2017
AB046823	1.2e-101	32.9	KIAA1603
AB023161	6.4e-91	34.8	KIAA0944

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013602	1	285	PF08393	Dynein heavy chain
	IPR011704	728	872	PF07728	ATPase associated with various cellular activities
	IPR004273	2364	2991	PF03028	Dynein heavy chain
HMMSmart	IPR003593	447	583	SM00382	AAA+ ATPase
	IPR003593	725	857	SM00382	AAA+ ATPase
	IPR003593	1052	1203	SM00382	AAA+ ATPase
	IPR003593	1399	1502	SM00382	AAA+ ATPase
ScanRegExp	IPR005479	2599	2606	PS00867	Carbamoyl-phosphate synthase L chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1955	ERTLCGDILLITAFISYLGFFT	1976	PRIMARY	22

Primer_f	CCACATTCCTTCAGCTCAGCC
Primer_r	CACCACAGACACTTAGAACGG
PCR conditions	95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCACATTCCTTCAGCTCAGCC
Primer_r	CACCACAGACACTTAGAACGG
PCR product length	112 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles