ROUGE |
Gene/Protein Characteristic Table for mKIAA4241 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220565 |
---|---|
Cytohesin 3. | |
mfj17221 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3717 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2341 bp Genome contig ID gi65498774f_142583052 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CTGTGTTCCCTAAATAAAAACATACTGCTAAAACCFlanking genome sequence
(187785 - 187834) ----+----*----+----*----+----*----+----*----+----*
AAAACTGCCTAAGACTCAATTCTTTAAAACAGACATGGCTATGAGCTTGC
Features of the protein sequence |
Description | |
Coding region: 15..1373
Length: 453 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |