Gene/Protein Characteristic Table for mKIAA4240

Length: 3096 bp

Restriction map

Length of 3'UTR	1845 bp
Genome contig ID	gi65527427r_117885265
PolyA signal sequence (AATAAA,-25)	+----*----+----*----+----*----+---- AACTGCAGCAAATAAACTCCAAATCTGCCCACATC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ACTTCATGTTCTGCTCTGCTGTGGGGTCATCTCTTGTCAAGCCTGGGACT

Coding region: 1..1248

Length: 416 aa

Entry Exp ID% Protein Source P97694 1.3e-160 99.7 Cytohesin-1; PH... Rattus norvegicus BAE42931 2.6e-160 99.5 unnamed protein... Mus musculus Q9QX11 3e-160 99.5 Cytohesin-1; PH... Mus musculus BAA33428 2.4e-159 99.5 cytohesin 1 [Mu... Mus musculus Q15438 3.3e-158 98.0 Cytohesin-1; PH... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220565 1.2e-102 84.3 mKIAA4241 AK220198 1.4e-85 70.3 mFLJ00017 AK220355 4.4e-21 41.7 mKIAA0763 AK122446 1.3e-20 35.9 mKIAA1110 AK172919 4.6e-18 40.2 mKIAA0248

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000904	77	262	PF01369	SEC7-like
	IPR001849	279	395	PF00169	Pleckstrin-like
HMMSmart	IPR000904	77	262	SM00222	SEC7-like
	IPR001849	279	397	SM00233	Pleckstrin-like
ProfileScan	IPR000904	73	260	PS50190	SEC7-like
	IPR001849	278	395	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-