Gene/Protein Characteristic Table for mFLJ00017

Length: 2737 bp

Restriction map

Length of 3'UTR	1472 bp
Genome contig ID	gi65543215f_78548404
PolyA signal sequence (AATAAA,-25)	+----*----+----*----+----*----+---- CAGGAGCAAGAATAAAAGCTCATGACGTCGCTCGT
Flanking genome sequence (124897 - 124946)	----+----*----+----*----+----*----+----*----+----* AGACTGAAGAAAGCTATTCTTCTGTAATTGTGTCACCATCCCTGAGCCCC

KIAA	Alignment based on:
FLJ00017	DNA sequence, AA sequence, Physical map

Coding region: 39..1265

Length: 408 aa

Entry Exp ID% Protein Source BAD90123 6.4e-178 100.0 mFLJ00017 prote... Mus musculus Q80YW0 6.5e-171 100.0 Cytohesin-4; PH... Mus musculus BAE31588 2.6e-170 99.7 unnamed protein... Mus musculus BAE31112 3.5e-170 99.7 unnamed protein... Mus musculus EDM15856 4.9e-166 97.2 similar to cyto... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220565 5.9e-102 71.8 mKIAA4241 AK220302 1.7e-98 70.3 mKIAA4240 AK220355 1.5e-22 38.2 mKIAA0763 AK122446 1.1e-21 39.4 mKIAA1110 AK172919 1.2e-20 35.6 mKIAA0248

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000904	72	258	PF01369	SEC7-like
	IPR001849	275	390	PF00169	Pleckstrin-like
HMMSmart	IPR000904	73	258	SM00222	SEC7-like
	IPR001849	275	392	SM00233	Pleckstrin-like
ProfileScan	IPR000904	69	256	PS50190	SEC7-like
	IPR001849	274	390	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-