ROUGE |
Gene/Protein Characteristic Table for mKIAA1420 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC052194 |
---|---|
Similar to absent, small, or homeotic discs 1 (Fragment). | |
mfj05028 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5015 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2290 bp Genome contig ID gi65492966f_88679238 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
TGAAAGTCTAGCATTAAATGGAAACAACTTTTCCTFlanking genome sequence
(144002 - 144051) ----+----*----+----*----+----*----+----*----+----*
AACTGTGGAGTCTTTGTGCCTCTTTCCTACCTGCAGTACCTTCCGGCACC
KIAA Alignment based on: KIAA1420 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..2722
Length: 907 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |