Gene/Protein Characteristic Table for mKIAA1876

Length: 1335 bp

Restriction map

Length of 3'UTR	288 bp
Genome contig ID	gi66880554r_24623319
PolyA signal sequence (AATAAA,-17)	+----*----+----*----+----*----+---- CTCTACTCACCACATGAAAATAAACTATCAACTGT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAGAAAAAGAACAAAATGATTTTAGAATAAAGTGCAGGA

KIAA	Alignment based on:
KIAA1876	DNA sequence, AA sequence, Physical map

Coding region: 1..1047

Length: 348 aa

Entry Exp ID% Protein Source BAC33756 4.4e-154 100.0 unnamed protein... Mus musculus AAH56938 5.3e-154 100.0 Ehmt1 protein [... Mus musculus AAH89302 5.5e-154 100.0 Ehmt1 protein [... Mus musculus NP_001103156 5.6e-154 100.0 euchromatic his... Mus musculus NP_001103157 5.6e-154 100.0 euchromatic his... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID BC007135 5.1e-15 33.0 mKIAA0388 BC052194 1.3e-14 30.7 mKIAA1420 AK220174 2.9e-14 32.7 mKIAA4065 AK129287 1.3e-13 30.2 mKIAA1090 AK122198 2.7e-12 35.9 mKIAA0067

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007728	53	158	PF05033	Pre-SET
	IPR001214	160	290	PF00856	Nuclear protein SET
HMMSmart	IPR003606	51	150	SM00468	Nuclear protein Zn2+-binding
	IPR001214	166	289	SM00317	Nuclear protein SET
ProfileScan	IPR001214	177	287	PS50280	Nuclear protein SET

Method	From	To	amino acid sequence
-	-	-	-