ROUGE

Gene/Protein Characteristic Table for mKIAA1090

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129287
Description :	IL-5 promoter REII-region-binding protein homolog.
Clone Name :	mph00524 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3381 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 316 bp

Genome contig ID gi65498774f_32243627
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
ATTTCTATTTTAGATTAAAGTTATGATTGAAGATT
Flanking genome sequence
(140132 - 140181)
----+----*----+----*----+----*----+----*----+----*
AACTGGCATGTGAAATGCTTTTATCTTACCTGAAACAAAGAATTTTCTAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1090 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1090	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 492..3065
Length: 857 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH46473	99.9	Whsc1 protein [...	Mus musculus
AAI56161	99.9	Wolf-Hirschhorn...	synthetic construct
Q8BVE8	99.8	Probable histon...	Mus musculus
XP_001058413	97.9	similar to Wolf...	Rattus norvegicus
XP_001058474	97.7	similar to Wolf...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC052194	2.9e-23	39.4	mKIAA1420
BC007135	2.7e-10	31.8	mKIAA0388
AK220174	1.2e-09	32.4	mKIAA4065
AK122435	2.5e-08	32.4	mKIAA1076
AK129461	2.8e-08	30.6	mKIAA1876

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001965 161 205 PF00628 Zinc finger

IPR001965 325 367 PF00628 Zinc finger

IPR000313 369 445 PF00855 PWWP

IPR001214 549 678 PF00856 Nuclear protein SET

HMMSmart IPR001965 161 203 SM00249 Zinc finger

IPR001965 208 255 SM00249 Zinc finger

IPR001965 256 309 SM00249 Zinc finger

IPR001965 325 365 SM00249 Zinc finger

IPR000313 370 432 SM00293 PWWP

IPR001214 555 678 SM00317 Nuclear protein SET

IPR003616 679 695 SM00508 SET-related region

IPR001965 733 776 SM00249 Zinc finger

ProfileScan IPR001965 159 205 PS50016 Zinc finger

IPR001841 209 255 PS50089 Zinc finger

IPR001965 323 367 PS50016 Zinc finger

IPR000313 372 434 PS50812 PWWP

IPR001214 566 676 PS50280 Nuclear protein SET

ScanRegExp IPR001965 162 202 PS01359 Zinc finger

IPR001965 326 364 PS01359 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	161	205	PF00628	Zinc finger
IPR001965	325	367	PF00628	Zinc finger
IPR000313	369	445	PF00855	PWWP
IPR001214	549	678	PF00856	Nuclear protein SET
HMMSmart	IPR001965	161	203	SM00249	Zinc finger
IPR001965	208	255	SM00249	Zinc finger
IPR001965	256	309	SM00249	Zinc finger
IPR001965	325	365	SM00249	Zinc finger
IPR000313	370	432	SM00293	PWWP
IPR001214	555	678	SM00317	Nuclear protein SET
IPR003616	679	695	SM00508	SET-related region
IPR001965	733	776	SM00249	Zinc finger
ProfileScan	IPR001965	159	205	PS50016	Zinc finger
IPR001841	209	255	PS50089	Zinc finger
IPR001965	323	367	PS50016	Zinc finger
IPR000313	372	434	PS50812	PWWP
IPR001214	566	676	PS50280	Nuclear protein SET
ScanRegExp	IPR001965	162	202	PS01359	Zinc finger
IPR001965	326	364	PS01359	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	316 bp
Genome contig ID	gi65498774f_32243627
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ATTTCTATTTTAGATTAAAGTTATGATTGAAGATT
Flanking genome sequence (140132 - 140181)	----+--------+--------+--------+--------+----* AACTGGCATGTGAAATGCTTTTATCTTACCTGAAACAAAGAATTTTCTAA

Gene/Protein Characteristic Table for mKIAA1090

Features of the cloned DNA sequence

Features of the protein sequence