Gene/Protein Characteristic Table for mKIAA4065

Length: 2600 bp

Restriction map

Length of 3'UTR	260 bp
Genome contig ID	gi65504368r_47631972
PolyA signal sequence (AATAAA,-22)	+----*----+----*----+----*----+---- TTTTTCAAATTTGAATAAAGAATACTTGAACTTGT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* TGTTGAATCACTTGTCCTAGAACATCACCGACTGATTCTAGAAAGACTAT

Coding region: 1..2337

Length: 779 aa

Entry Exp ID% Protein Source AAH03772 0 100.0 Enhancer of zes... Mus musculus Q61188 0 99.9 Histone-lysine ... Mus musculus EDM15557 0 99.7 similar to Enha... Rattus norvegicus BAE34232 0 99.9 unnamed protein... Mus musculus XP_001504679 0 98.7 enhancer of zes... Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID BC007135 4.4e-110 65.1 mKIAA0388 BC052194 1.2e-09 31.9 mKIAA1420 AK129287 1.4e-09 33.3 mKIAA1090 AK122435 1.7e-09 41.1 mKIAA1076 BC049883 8.6e-09 24.7 mKIAA0339

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001214	639	766	PF00856	Nuclear protein SET
HMMSmart	NULL	192	283	SM00395	NULL
	NULL	461	509	SM00395	NULL
	IPR001214	645	766	SM00317	Nuclear protein SET
ProfileScan	NULL	7	38	PS50315	NULL
	NULL	216	242	PS50312	NULL
	NULL	556	621	PS50311	NULL
	IPR001214	656	764	PS50280	Nuclear protein SET

Method	From	To	amino acid sequence
-	-	-	-