ROUGE |
Gene/Protein Characteristic Table for mKIAA1142 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129298 |
---|---|
Serine/threonine-protein kinase PAK 4. | |
mph00410 [Vector Info] | |
Source : | Mouse embryonic tail |
Note : | We replaced mph01290, former representative clones for mKIAA1142 with mph00410. (2005/2/23) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2897 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 834 bp Genome contig ID gi65511124r_23864693 PolyA signal sequence
(ATTAAA,-29) +----*----+----*----+----*----+----
TTTACAATTAAAGTATTTTCTTGTTTTTGGTGAATFlanking genome sequence
(99999 - 99950) ----+----*----+----*----+----*----+----*----+----*
GTGTGTGTATGTGTGTGGTCTATGGAGGCTACTGTCCAGCTATGTAGTAA
KIAA Alignment based on: KIAA1142 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 270..2063
Length: 597 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |