Gene/Protein Characteristic Table for mKIAA1101

Length: 4633 bp

Restriction map

Length of 3'UTR	2701 bp
Genome contig ID	gi65519420r_119132751
PolyA signal sequence (AATAAA,-27)	+----*----+----*----+----*----+---- TTTTAATCAATAAAGAGTAAATTGTCCTTAATGAT
Flanking genome sequence (99950 - 99901)	----+----*----+----*----+----*----+----*----+----* ATATAAATGCTTTCATTTATTTATTTATTTTGATGGCGGTGGTTGGGAAG

KIAA	Alignment based on:
KIAA1101	DNA sequence, AA sequence, Physical map

Coding region: 111..812, 856..1932

Length: 592 aa

Entry Exp ID% Protein Source XP_859626 2.6e-145 89.9 similar to oxid... Canis lupus fam... XP_001362843 3.2e-139 80.2 hypothetical pr... Monodelphis dom... EDL09228 2.2e-119 95.2 mCG20975, isofo... Mus musculus BAC35996 2.2e-119 97.0 unnamed protein... Mus musculus Q6P9R2 2.4e-119 97.3 Serine/threonin... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129298 1.2e-18 37.0 mKIAA1142 AK129235 1.5e-17 32.7 mKIAA0881 AK220448 2.1e-15 30.5 mKIAA4026 AK122218 4.6e-14 27.5 mKIAA0204 AK220528 3.5e-12 41.5 mKIAA4182

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	96	356	PD000001	Protein kinase
HMMPfam	NULL	96	356	PF07714	NULL
	IPR000719	96	356	PF00069	Protein kinase
HMMSmart	IPR002290	96	356	SM00220	Serine/threonine protein kinase
	IPR001245	96	356	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	96	356	PS50011	Protein kinase
ScanRegExp	IPR000719	102	125	PS00107	Protein kinase

Method	From	To	amino acid sequence
-	-	-	-