Gene/Protein Characteristic Table for mKIAA4026

Length: 4968 bp

Restriction map

Length of 3'UTR	2007 bp
Genome contig ID	gi65527427f_32328139
PolyA signal sequence (AATAAA,-22)	+----*----+----*----+----*----+---- TAAATATGCTTCTAATAAAGTAATAAGGTGATTTG
Flanking genome sequence (191250 - 191299)	----+----*----+----*----+----*----+----*----+----* CAAGCACTGTTGTTCTTTCTGGTTGGAAAGAGAAGATAGGTGGGCCTCCT

Coding region: 1..2958

Length: 986 aa

Entry Exp ID% Protein Source ABK42257 0 100.0 Stk10 [syntheti... synthetic construct CAI25517 0 99.8 serine/threonin... Mus musculus O55098 0 99.7 Serine/threonin... Mus musculus BAE28356 0 99.6 unnamed protein... Mus musculus O94804 0 88.7 Serine/threonin... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122218 1.2e-38 46.0 mKIAA0204 AK129235 1.6e-15 26.2 mKIAA0881 AK220528 5.3e-11 44.1 mKIAA4182 AK129298 8.6e-11 33.1 mKIAA1142 AK122219 9.5e-08 33.2 mKIAA0213

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	62	313	PD000001	Protein kinase
HMMPfam	NULL	56	314	PF07714	NULL
	IPR000719	56	314	PF00069	Protein kinase
HMMSmart	IPR002290	56	314	SM00220	Serine/threonine protein kinase
	IPR001245	56	317	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	56	314	PS50011	Protein kinase
	NULL	769	903	PS50322	NULL
ScanRegExp	IPR000719	62	85	PS00107	Protein kinase
	IPR008271	173	185	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
-	-	-	-