Order Kazusa clone(s) from : ![]() |
Product ID | ORK00749 |
---|---|
Accession No | AB032968 |
Description | p21 protein (Cdc42/Rac)-activated kinase 4, transcript variant 5 |
Clone name | hh05864 |
Vector information | |
cDNA sequence | DNA sequence (5742 bp) Predicted protein sequence (467 aa) |
HaloTag ORF Clone |
FHC00749
![]() |
Flexi ORF Clone | FXC00749 |
Source | Human adult brain |
Rouge ID |
mKIAA1142
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4244 bp |
---|---|
Genome contig ID | gi42406306f_44208314 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (156984 - 157033) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 44308314 | 44365296 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 203 | 447 | PD000001 | Protein kinase |
HMMPfam | IPR000095 | 39 | 96 | PF00786 | PAK-box/P21-Rho-binding |
IPR000719 | 197 | 448 | PF00069 | Protein kinase | |
HMMSmart | IPR000095 | 40 | 75 | SM00285 | PAK-box/P21-Rho-binding |
IPR001245 | 197 | 448 | SM00219 | Tyrosine protein kinase | |
IPR002290 | 197 | 448 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000095 | 40 | 53 | PS50108 | PAK-box/P21-Rho-binding |
IPR000719 | 197 | 448 | PS50011 | Protein kinase | |
ScanRegExp | IPR000719 | 203 | 227 | PS00107 | Protein kinase |
![]() |
Primer_f | AGGTCATAGCAGCCAGTAAGC |
---|---|
Primer_r | TACTCACCAAACGCGCTCAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |