ROUGE |
Gene/Protein Characteristic Table for mKIAA0204 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122218 |
---|---|
serine/threonine kinase 2. Ste20-related kinase. |
|
mbg01039 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5840 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1715 bp Genome contig ID gi65553144f_47030979 PolyA signal sequence
(GATAAA,-21) +----*----+----*----+----*----+----
GTTTATATTGTTATGATAAAAGATGGTATTATGTTFlanking genome sequence
(164132 - 164181) ----+----*----+----*----+----*----+----*----+----*
ACCTAGTGTATTTAATGACTTATTTGAAGAGGGAGAGGGGAGGAAGGCTC
KIAA Alignment based on: KIAA0204 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 202..4125
Length: 1307 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |