ROUGE

Gene/Protein Characteristic Table for mKIAA0204

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122218
Description :	serine/threonine kinase 2. Ste20-related kinase.
Clone Name :	mbg01039 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5840 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1715 bp

Genome contig ID gi65553144f_47030979
PolyA signal sequence
(GATAAA,-21)
+----*----+----*----+----*----+----
GTTTATATTGTTATGATAAAAGATGGTATTATGTT
Flanking genome sequence
(164132 - 164181)
----+----*----+----*----+----*----+----*----+----*
ACCTAGTGTATTTAATGACTTATTTGAAGAGGGAGAGGGGAGGAAGGCTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0204 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0204	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 202..4125
Length: 1307 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAD28717	100.0	Ste20-related k...	Mus musculus
EDL94383	91.9	rCG57812, isofo...	Rattus norvegicus
NP_062222	91.4	serine/threonin...	Rattus norvegicus
O08815	91.3	STE20-like seri...	Rattus norvegicus
EDL42036	97.6	STE20-like kina...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220448	1e-40	46.0	mKIAA4026
AK129235	3e-14	24.3	mKIAA0881
AK129298	6e-13	31.9	mKIAA1142
AK220528	1.9e-12	44.9	mKIAA4182
AK122219	1.4e-09	31.4	mKIAA0213

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 145 396 PD000001 Protein kinase

HMMPfam NULL 139 397 PF07714 NULL

IPR000719 139 397 PF00069 Protein kinase

HMMSmart IPR002290 139 397 SM00220 Serine/threonine protein kinase

IPR001245 139 397 SM00219 Tyrosine protein kinase

ProfileScan NULL 5 78 PS50323 NULL

IPR000719 139 397 PS50011 Protein kinase

NULL 407 786 PS50313 NULL

NULL 941 1221 PS50322 NULL

IPR001943 978 1013 PS50151 UvrB/UvrC protein

ScanRegExp IPR000719 145 168 PS00107 Protein kinase

IPR008271 256 268 PS00108 Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	145	396	PD000001	Protein kinase
HMMPfam	NULL	139	397	PF07714	NULL
IPR000719	139	397	PF00069	Protein kinase
HMMSmart	IPR002290	139	397	SM00220	Serine/threonine protein kinase
IPR001245	139	397	SM00219	Tyrosine protein kinase
ProfileScan	NULL	5	78	PS50323	NULL
IPR000719	139	397	PS50011	Protein kinase
NULL	407	786	PS50313	NULL
NULL	941	1221	PS50322	NULL
IPR001943	978	1013	PS50151	UvrB/UvrC protein
ScanRegExp	IPR000719	145	168	PS00107	Protein kinase
IPR008271	256	268	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1715 bp
Genome contig ID	gi65553144f_47030979
PolyA signal sequence (GATAAA,-21)	+--------+--------+----*----+---- GTTTATATTGTTATGATAAAAGATGGTATTATGTT
Flanking genome sequence (164132 - 164181)	----+--------+--------+--------+--------+----* ACCTAGTGTATTTAATGACTTATTTGAAGAGGGAGAGGGGAGGAAGGCTC

Gene/Protein Characteristic Table for mKIAA0204

Features of the cloned DNA sequence

Features of the protein sequence