ROUGE

Gene/Protein Characteristic Table for mKIAA1122

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122454
Description :	SWI/SNF-related, matrix associated, actin-dependent regulator of chromatin subfamily A containing DEAD/H box 1.
Clone Name :	mbh00587 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 4453 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1235 bp

Genome contig ID gi65504368f_65194842
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTAAATATCATTATAAATAAACTTATTTATAAATG
Flanking genome sequence
(172739 - 172788)
----+----*----+----*----+----*----+----*----+----*
AGAGATTTGTTAATTATTGTAGCTCATACTTTTCAAGACACCCCCAGTGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1122 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1122	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3218
Length: 1071 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAA49560	99.9	enhancer-trap-l...	Mus musculus
Q04692	100.0	SWI/SNF-related...	Mus musculus
NP_001101334	97.1	SWI/SNF-related...	Rattus norvegicus
Q9H4L7	92.4	SWI/SNF-related...	Homo sapiens
EAX06050	92.3	SWI/SNF-related...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129317	4.1e-18	29.5	mKIAA1259
AK220473	7.9e-14	32.2	mKIAA4075
AB093226	1.5e-12	35.2	mKIAA0308
AJ132389	1e-05	26.8	mKIAA0809

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000330 545 833 PF00176 SNF2-related

IPR001650 934 1012 PF00271 Helicase

HMMSmart IPR011545 538 732 SM00487 DEAD/DEAH box helicase

IPR001650 929 1012 SM00490 Helicase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	545	833	PF00176	SNF2-related
IPR001650	934	1012	PF00271	Helicase
HMMSmart	IPR011545	538	732	SM00487	DEAD/DEAH box helicase
IPR001650	929	1012	SM00490	Helicase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1235 bp
Genome contig ID	gi65504368f_65194842
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTAAATATCATTATAAATAAACTTATTTATAAATG
Flanking genome sequence (172739 - 172788)	----+--------+--------+--------+--------+----* AGAGATTTGTTAATTATTGTAGCTCATACTTTTCAAGACACCCCCAGTGC

Gene/Protein Characteristic Table for mKIAA1122

Features of the cloned DNA sequence

Features of the protein sequence