ROUGE

Gene/Protein Characteristic Table for mKIAA4075

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220473
Description :	chromodomain helicase DNA binding protein 4. Mi-2 beta.
Clone Name :	mbg09037 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6337 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 498 bp

Genome contig ID gi65504368f_125653107
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
GCGGCTCCAGCCACTGAGCAGCTAAATAAAGTTGG
Flanking genome sequence
(133369 - 133418)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAAAAAGAACCAAAAGCATAAAAAACCACAGCAAA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 2..5836
Length: 1945 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001063352	98.6	similar to chro...	Rattus norvegicus
Q6PDQ2	99.4	Chromodomain-he...	Mus musculus
XP_232354	98.3	similar to chro...	Rattus norvegicus
XP_867860	97.5	similar to chro...	Canis lupus fam...
XP_002197085	90.9	similar to chro...	Taeniopygia guttata

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129145	2.1e-40	67.5	mKIAA0444
AB093226	9.3e-35	38.7	mKIAA0308
AK129317	5.7e-13	24.6	mKIAA1259
AK122454	1.4e-09	32.2	mKIAA1122
AJ132389	0.00013	26.3	mKIAA0809

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012958 184 238 PF08073 CHD

IPR001965 393 438 PF00628 Zinc finger

IPR001965 472 517 PF00628 Zinc finger

IPR000953 643 695 PF00385 Chromo

IPR006935 745 927 PF04851 Type III restriction enzyme

IPR000330 750 1046 PF00176 SNF2-related

IPR001650 1106 1185 PF00271 Helicase

IPR009463 1309 1374 PF06465 Protein of unknown function DUF1087

IPR009462 1387 1544 PF06461 Protein of unknown function DUF1086

IPR012957 1757 1929 PF08074 CHD

HMMSmart IPR001965 393 436 SM00249 Zinc finger

IPR001965 472 515 SM00249 Zinc finger

IPR000953 520 600 SM00298 Chromo

IPR000953 641 698 SM00298 Chromo

IPR011545 743 955 SM00487 DEAD/DEAH box helicase

IPR001650 1101 1185 SM00490 Helicase

ProfileScan NULL 71 154 PS50318 NULL

IPR001965 391 438 PS50016 Zinc finger

IPR001965 470 517 PS50016 Zinc finger

IPR000694 499 560 PS50099 Proline-rich region

IPR000953 550 607 PS50013 Chromo

IPR000953 643 678 PS50013 Chromo

NULL 1588 1701 PS50313 NULL

ScanRegExp IPR001965 394 435 PS01359 Zinc finger

IPR001965 473 514 PS01359 Zinc finger

IPR000953 564 584 PS00598 Chromo

IPR000953 661 680 PS00598 Chromo

IPR002464 889 898 PS00690 ATP-dependent helicase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012958	184	238	PF08073	CHD
IPR001965	393	438	PF00628	Zinc finger
IPR001965	472	517	PF00628	Zinc finger
IPR000953	643	695	PF00385	Chromo
IPR006935	745	927	PF04851	Type III restriction enzyme
IPR000330	750	1046	PF00176	SNF2-related
IPR001650	1106	1185	PF00271	Helicase
IPR009463	1309	1374	PF06465	Protein of unknown function DUF1087
IPR009462	1387	1544	PF06461	Protein of unknown function DUF1086
IPR012957	1757	1929	PF08074	CHD
HMMSmart	IPR001965	393	436	SM00249	Zinc finger
IPR001965	472	515	SM00249	Zinc finger
IPR000953	520	600	SM00298	Chromo
IPR000953	641	698	SM00298	Chromo
IPR011545	743	955	SM00487	DEAD/DEAH box helicase
IPR001650	1101	1185	SM00490	Helicase
ProfileScan	NULL	71	154	PS50318	NULL
IPR001965	391	438	PS50016	Zinc finger
IPR001965	470	517	PS50016	Zinc finger
IPR000694	499	560	PS50099	Proline-rich region
IPR000953	550	607	PS50013	Chromo
IPR000953	643	678	PS50013	Chromo
NULL	1588	1701	PS50313	NULL
ScanRegExp	IPR001965	394	435	PS01359	Zinc finger
IPR001965	473	514	PS01359	Zinc finger
IPR000953	564	584	PS00598	Chromo
IPR000953	661	680	PS00598	Chromo
IPR002464	889	898	PS00690	ATP-dependent helicase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	498 bp
Genome contig ID	gi65504368f_125653107
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- GCGGCTCCAGCCACTGAGCAGCTAAATAAAGTTGG
Flanking genome sequence (133369 - 133418)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAAAAAGAACCAAAAGCATAAAAAACCACAGCAAA

Gene/Protein Characteristic Table for mKIAA4075

Features of the cloned DNA sequence

Features of the protein sequence