| ROUGE | 
| Gene/Protein Characteristic Table for mKIAA0308 | 
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AB093226 | 
|---|---|
| mia33045 [Vector Info] | |
| Source : | Mouse adult pancreatic islet | 
| Note : | We replaced mbg12486, former representative clones for mKIAA0308 with mia33045. (2004/6/22) | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 8209 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | YES | 
| Warning for coding interruption: | NO | 
Length of 3'UTR 2536 bp Genome contig ID gi65515060f_90181011 PolyA signal sequence 
(ATTAAA,-20)
GTTTAATTATTTTTTATTAAACATATTCTTTGACTFlanking genome sequence 
(160025 - 160074)
ACCCATGATGTCAGCCTCCCTCCGTACCTGACACTACTTTTTCACTTGAG
KIAA Alignment based on: KIAA0308 DNA sequence 
| Features of the protein sequence | Description | |
Coding region: 1..5673
Length: 1890 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 
    | How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage   | |