ROUGE |
Gene/Protein Characteristic Table for mKIAA0308 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB093226 |
---|---|
mia33045 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Note : | We replaced mbg12486, former representative clones for mKIAA0308 with mia33045. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8209 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2536 bp Genome contig ID gi65515060f_90181011 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
GTTTAATTATTTTTTATTAAACATATTCTTTGACTFlanking genome sequence
(160025 - 160074) ----+----*----+----*----+----*----+----*----+----*
ACCCATGATGTCAGCCTCCCTCCGTACCTGACACTACTTTTTCACTTGAG
KIAA Alignment based on: KIAA0308 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 1..5673
Length: 1890 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |