ROUGE

Gene/Protein Characteristic Table for mKIAA0308

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093226
Description :
Clone Name :	mia33045 [Vector Info]
Source :	Mouse adult pancreatic islet
Note :	We replaced mbg12486, former representative clones for mKIAA0308 with mia33045. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 8209 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2536 bp

Genome contig ID gi65515060f_90181011
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
GTTTAATTATTTTTTATTAAACATATTCTTTGACT
Flanking genome sequence
(160025 - 160074)
----+----*----+----*----+----*----+----*----+----*
ACCCATGATGTCAGCCTCCCTCCGTACCTGACACTACTTTTTCACTTGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0308 DNA sequence

KIAA	Alignment based on:
KIAA0308	DNA sequence

Features of the protein sequence	Description

Coding region: 1..5673
Length: 1890 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAZ73184	100.0	ciprofibrate-bo...	Mus musculus
XP_001062696	95.5	similar to chro...	Rattus norvegicus
XP_001512847	88.3	similar to chro...	Ornithorhynchus...
XP_510966	93.0	chromodomain he...	Pan troglodytes
EAW82795	92.8	chromodomain he...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220473	7.2e-32	38.5	mKIAA4075
AK129393	1.4e-22	35.1	mKIAA1564
AK129317	4.2e-11	36.1	mKIAA1259
AK122454	8.9e-08	35.2	mKIAA1122
AJ132389	0.00016	26.5	mKIAA0809

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000330 1 170 PF00176 SNF2-related

IPR001650 237 316 PF00271 Helicase

IPR006576 1477 1526 PF07533 BRK

IPR006576 1551 1595 PF07533 BRK

HMMSmart IPR001650 232 316 SM00490 Helicase

ProfileScan NULL 1148 1219 PS50324 NULL

NULL 1867 1887 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	1	170	PF00176	SNF2-related
IPR001650	237	316	PF00271	Helicase
IPR006576	1477	1526	PF07533	BRK
IPR006576	1551	1595	PF07533	BRK
HMMSmart	IPR001650	232	316	SM00490	Helicase
ProfileScan	NULL	1148	1219	PS50324	NULL
NULL	1867	1887	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2536 bp
Genome contig ID	gi65515060f_90181011
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- GTTTAATTATTTTTTATTAAACATATTCTTTGACT
Flanking genome sequence (160025 - 160074)	----+--------+--------+--------+--------+----* ACCCATGATGTCAGCCTCCCTCCGTACCTGACACTACTTTTTCACTTGAG

Gene/Protein Characteristic Table for mKIAA0308

Features of the cloned DNA sequence

Features of the protein sequence