ROUGE |
Gene/Protein Characteristic Table for mKIAA1027 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122420 |
---|---|
Talin 1. | |
mia05043 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Note : | We replaced mbg02823, former representative clones for mKIAA1027 with mia05043. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8180 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 441 bp Genome contig ID gi65493515r_43347442 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
CCAAACAGGTCAGACTCCAATAAAGGTGATTCTACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCTGCAGCCTGGCTTTATGAGGAGACGGGAGGTCTTCCTCAGGGACTCT
KIAA Alignment based on: KIAA1027 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 45..7739
Length: 2564 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |