ROUGE

Gene/Protein Characteristic Table for mKIAA0655

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129182
Description :	Huntingtin interacting protein 1 related.
Clone Name :	mfj00059 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4332 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1034 bp

Genome contig ID gi65498774f_123044657
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGAGTTCCATTGGCAATAAAACCCTGACTGTTGTT
Flanking genome sequence
(129870 - 129919)
----+----*----+----*----+----*----+----*----+----*
AGCAGTGCCCTAGTGAGGGCCTCTGCCAGACTCTTCATTTCTCCAGAGAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0655 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0655	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 47..3298
Length: 1083 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE27341	100.0	unnamed protein...	Mus musculus
BAB29420	99.9	unnamed protein...	Mus musculus
AAH65101	99.9	Huntingtin inte...	Mus musculus
Q9JKY5	99.9	Huntingtin-inte...	Mus musculus
BAB32404	96.9	huntingtin inte...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220182	3.8e-41	48.8	mKIAA4113
AK122420	3.3e-07	22.8	mKIAA1027
AB093231	8.2e-05	24.5	mKIAA0320

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002558 904 1024 PD011820 I/LWEQ

HMMPfam IPR011417 43 315 PF07651 ANTH

IPR001026 43 162 PF01417 Epsin

IPR002558 834 1027 PF01608 I/LWEQ

HMMSmart IPR001026 44 166 SM00273 Epsin

IPR002558 829 1027 SM00307 I/LWEQ

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002558	904	1024	PD011820	I/LWEQ
HMMPfam	IPR011417	43	315	PF07651	ANTH
IPR001026	43	162	PF01417	Epsin
IPR002558	834	1027	PF01608	I/LWEQ
HMMSmart	IPR001026	44	166	SM00273	Epsin
IPR002558	829	1027	SM00307	I/LWEQ

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1034 bp
Genome contig ID	gi65498774f_123044657
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGAGTTCCATTGGCAATAAAACCCTGACTGTTGTT
Flanking genome sequence (129870 - 129919)	----+--------+--------+--------+--------+----* AGCAGTGCCCTAGTGAGGGCCTCTGCCAGACTCTTCATTTCTCCAGAGAT

Gene/Protein Characteristic Table for mKIAA0655

Features of the cloned DNA sequence

Features of the protein sequence