ROUGE

Gene/Protein Characteristic Table for mKIAA4173

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK084510
Description :	Mesoderm development candidate 1.
Clone Name :	mid20040 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 2275 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 614 bp

Genome contig ID gi65511124r_77638151
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
ATTTATTTCATCTATTAAATTGTTATGTTTCTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGGCTTTTCGCAGTTACTGTCTTTTCACTAACTGTGCATGCCGCCTGCC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 516..1658
Length: 381 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9ERE8	3.6e-140	100.0	Mesoderm develo...	Mus musculus
Q9H1K6	6.9e-138	98.1	Mesoderm develo...	Homo sapiens
XP_510543	1.4e-137	97.8	mesoderm develo...	Pan troglodytes
XP_001109814	2.2e-137	97.5	similar to meso...	Macaca mulatta
XP_001916023	3e-137	98.1	mesoderm develo...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122420	3.5e-16	25.0	mKIAA1027
AB093231	1e-15	24.3	mKIAA0320

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	614 bp
Genome contig ID	gi65511124r_77638151
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ATTTATTTCATCTATTAAATTGTTATGTTTCTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGCTTTTCGCAGTTACTGTCTTTTCACTAACTGTGCATGCCGCCTGCC

Gene/Protein Characteristic Table for mKIAA4173

Features of the cloned DNA sequence

Features of the protein sequence