ROUGE

Gene/Protein Characteristic Table for mKIAA0793

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173028
Description :	FERM, RhoGEF and pleckstrin domain protein 2.
Clone Name :	mie09077 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 1166 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 603 bp

Genome contig ID gi65488608f_93346388
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
TTCAATGCTCTATTAAAACTAACACTTAATGTCAG
Flanking genome sequence
(103080 - 103129)
----+----*----+----*----+----*----+----*----+----*
AATACTCAGGAAGTTCAATTTTCCTAAAAAAAAAAAAAAAAAAACCCAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0793 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0793	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..563
Length: 186 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE42626	3.7e-85	99.5	unnamed protein...	Mus musculus
Q91VS8	3.7e-85	99.5	FERM, RhoGEF an...	Mus musculus
EDL91918	7.3e-82	96.2	FERM, RhoGEF an...	Rattus norvegicus
CAB59185	2.4e-63	84.1	hypothetical pr...	Homo sapiens
AAY14682	3e-63	84.1	unknown [Homo s...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173157	4.2e-09	35.9	mKIAA1362
BC011462	7e-08	31.8	mKIAA4239
AK220153	8.8e-08	32.6	mFLJ00274
AK129483	6.1e-07	28.7	mKIAA3018
AK129423	8.2e-07	25.0	mKIAA1686

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 52 148 PF00169 Pleckstrin-like

HMMSmart IPR001849 52 150 SM00233 Pleckstrin-like

ProfileScan IPR001849 51 148 PS50003 Pleckstrin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	52	148	PF00169	Pleckstrin-like
HMMSmart	IPR001849	52	150	SM00233	Pleckstrin-like
ProfileScan	IPR001849	51	148	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	603 bp
Genome contig ID	gi65488608f_93346388
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- TTCAATGCTCTATTAAAACTAACACTTAATGTCAG
Flanking genome sequence (103080 - 103129)	----+--------+--------+--------+--------+----* AATACTCAGGAAGTTCAATTTTCCTAAAAAAAAAAAAAAAAAAACCCAAA

Gene/Protein Characteristic Table for mKIAA0793

Features of the cloned DNA sequence

Features of the protein sequence