ROUGE

Gene/Protein Characteristic Table for mKIAA1362

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173157
Description :	FYVE, RhoGEF and PH domain containing 6. ethanol decreased 4.
Clone Name :	mia41047 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 7883 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3549 bp

Genome contig ID gi65524842f_93909504
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATAATTCATACAAAATAAATGTACTGTAATATCT
Flanking genome sequence
(209179 - 209228)
----+----*----+----*----+----*----+----*----+----*
ACTGCTGGTGTGAAGTCCTTTATTATAGAGGTTTTGGTTTGTACTGATTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1362 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1362	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 111..4334
Length: 1407 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q69ZL1	100.0	FYVE, RhoGEF an...	Mus musculus
AAI39023	99.4	Fgd6 protein [M...	Mus musculus
EDL21573	98.6	FYVE, RhoGEF an...	Mus musculus
BAC31876	99.2	unnamed protein...	Mus musculus
EDM16892	86.4	similar to FYVE...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220153	9e-48	30.6	mFLJ00274
BC011462	7.6e-23	26.5	mKIAA4239
AK122250	5.6e-08	25.4	mKIAA0337
AK220452	9.7e-07	23.5	mKIAA4037
AK122241	1.1e-05	37.0	mKIAA0305

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 853 1037 PF00621 DH

IPR001849 1068 1161 PF00169 Pleckstrin-like

IPR000306 1194 1259 PF01363 Zinc finger

IPR001849 1311 1406 PF00169 Pleckstrin-like

HMMSmart IPR000219 853 1037 SM00325 DH

IPR001849 1068 1163 SM00233 Pleckstrin-like

IPR000306 1191 1259 SM00064 Zinc finger

IPR001849 1311 1406 SM00233 Pleckstrin-like

ProfileScan IPR000694 18 83 PS50099 Proline-rich region

IPR000219 849 1038 PS50010 DH

IPR001849 1067 1161 PS50003 Pleckstrin-like

IPR000306 1199 1258 PS50178 Zinc finger

IPR001849 1310 1406 PS50003 Pleckstrin-like

ScanRegExp IPR001304 1205 1229 PS00615 C-type lectin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	853	1037	PF00621	DH
IPR001849	1068	1161	PF00169	Pleckstrin-like
IPR000306	1194	1259	PF01363	Zinc finger
IPR001849	1311	1406	PF00169	Pleckstrin-like
HMMSmart	IPR000219	853	1037	SM00325	DH
IPR001849	1068	1163	SM00233	Pleckstrin-like
IPR000306	1191	1259	SM00064	Zinc finger
IPR001849	1311	1406	SM00233	Pleckstrin-like
ProfileScan	IPR000694	18	83	PS50099	Proline-rich region
IPR000219	849	1038	PS50010	DH
IPR001849	1067	1161	PS50003	Pleckstrin-like
IPR000306	1199	1258	PS50178	Zinc finger
IPR001849	1310	1406	PS50003	Pleckstrin-like
ScanRegExp	IPR001304	1205	1229	PS00615	C-type lectin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3549 bp
Genome contig ID	gi65524842f_93909504
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATAATTCATACAAAATAAATGTACTGTAATATCT
Flanking genome sequence (209179 - 209228)	----+--------+--------+--------+--------+----* ACTGCTGGTGTGAAGTCCTTTATTATAGAGGTTTTGGTTTGTACTGATTG

Gene/Protein Characteristic Table for mKIAA1362

Features of the cloned DNA sequence

Features of the protein sequence