ROUGE |
Gene/Protein Characteristic Table for mFLJ00274 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220153 |
---|---|
FYVE, RhoGEF and PH domain containing 5. | |
mpf00869 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6096 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1399 bp Genome contig ID gi65504368f_92326922 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
AAATTCCAGAAATAAAAGTGCATGAATTTCCAGTCFlanking genome sequence
(197041 - 197090) ----+----*----+----*----+----*----+----*----+----*
ATTTTTACTTGTAGTATAAATGTCCTACTGCATTAGTTAAGCTTCTCTAG
KIAA Alignment based on: FLJ00274 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 105..4697
Length: 1530 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |