| ROUGE |
Gene/Protein Characteristic Table for mKIAA3018 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129483 |
|---|---|
| actin filament associated protein. | |
| mbg08136 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6526 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4179 bp Genome contig ID gi65498774f_34280905 PolyA signal sequence
(None)
TCCTCCTGACAGTGGCTCATGGCACAGGAGATGTCFlanking genome sequence
(210529 - 210578)
CGTAGTTGTCTGAGTCGTCACTTCTGATCGCTCGACAGGTGGGAGGGGCT
Features of the protein sequence |
Description | |
Coding region: 149..2344
Length: 732 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001849 | 154 | 249 | PF00169 | Pleckstrin-like |
| IPR001849 | 350 | 443 | PF00169 | Pleckstrin-like | |
| HMMSmart | IPR001849 | 154 | 251 | SM00233 | Pleckstrin-like |
| IPR001849 | 350 | 445 | SM00233 | Pleckstrin-like | |
| ProfileScan | IPR000694 | 60 | 106 | PS50099 | Proline-rich region |
| IPR001849 | 153 | 249 | PS50003 | Pleckstrin-like | |
| IPR001849 | 349 | 443 | PS50003 | Pleckstrin-like |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
