ROUGE |
Gene/Protein Characteristic Table for mKIAA3018 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129483 |
---|---|
actin filament associated protein. | |
mbg08136 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6526 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4179 bp Genome contig ID gi65498774f_34280905 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCCTCCTGACAGTGGCTCATGGCACAGGAGATGTCFlanking genome sequence
(210529 - 210578) ----+----*----+----*----+----*----+----*----+----*
CGTAGTTGTCTGAGTCGTCACTTCTGATCGCTCGACAGGTGGGAGGGGCT
Features of the protein sequence |
Description | |
Coding region: 149..2344
Length: 732 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001849 | 154 | 249 | PF00169 | Pleckstrin-like |
IPR001849 | 350 | 443 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001849 | 154 | 251 | SM00233 | Pleckstrin-like |
IPR001849 | 350 | 445 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR000694 | 60 | 106 | PS50099 | Proline-rich region |
IPR001849 | 153 | 249 | PS50003 | Pleckstrin-like | |
IPR001849 | 349 | 443 | PS50003 | Pleckstrin-like |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |