ROUGE |
Gene/Protein Characteristic Table for mKIAA0705 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122349 |
---|---|
Atrophin-1 interacting protein 1. | |
mbg00550 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6008 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2642 bp Genome contig ID gi65498774f_18405236 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
ATATTCTAAAACACTGTCAAATAAAATATATATCCFlanking genome sequence
(751563 - 751612) ----+----*----+----*----+----*----+----*----+----*
AAAAATCTTTTCTTTTTCCAGCTATATAAACTGTGTGTTAATTTTAATTT
KIAA Alignment based on: KIAA0705 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..3342, 3456..3872
Length: 1252 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |