ROUGE

Gene/Protein Characteristic Table for mKIAA1634

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173225
Description :	membrane-associated guanylate kinase-related.
Clone Name :	mbg16650 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5216 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2843 bp

Genome contig ID gi65492966r_103340533
PolyA signal sequence
(ATTAAA,-10)
+----*----+----*----+----*----+----
ATCGCTCGTTATTTTTTATATAGATATTAAAAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAGTTTGTCGTGCTTTTTTCTAAAACTGTTAGCATCATTTAAAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1634 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1634	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..2370, 2372..3514
Length: 1170 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAG43836	100.0	membrane-associ...	Mus musculus
EDL07576	100.0	membrane associ...	Mus musculus
BAC26773	99.9	unnamed protein...	Mus musculus
EDL07574	97.3	membrane associ...	Mus musculus
Q9EQJ9	97.4	Membrane-associ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220499	1.7e-26	43.0	mKIAA4129
AK122349	3e-23	44.1	mKIAA0705
AK220189	5.6e-05	24.2	mKIAA4187
AK122211	0.0003	20.5	mKIAA0147
AK122411	0.00063	24.3	mKIAA0973

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001202 8 37 PF00397 WW/Rsp5/WWP

IPR001478 77 158 PF00595 PDZ/DHR/GLGF

IPR001478 393 474 PF00595 PDZ/DHR/GLGF

IPR001478 516 600 PF00595 PDZ/DHR/GLGF

IPR001478 686 765 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001202 7 39 SM00456 WW/Rsp5/WWP

IPR001478 85 161 SM00228 PDZ/DHR/GLGF

IPR001478 253 323 SM00228 PDZ/DHR/GLGF

IPR001478 401 477 SM00228 PDZ/DHR/GLGF

IPR001478 525 603 SM00228 PDZ/DHR/GLGF

IPR001478 694 768 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001202 6 39 PS50020 WW/Rsp5/WWP

IPR001478 77 145 PS50106 PDZ/DHR/GLGF

IPR001478 245 308 PS50106 PDZ/DHR/GLGF

IPR001478 393 475 PS50106 PDZ/DHR/GLGF

IPR001478 516 603 PS50106 PDZ/DHR/GLGF

IPR001478 686 768 PS50106 PDZ/DHR/GLGF

ScanRegExp IPR001202 12 37 PS01159 WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001202	8	37	PF00397	WW/Rsp5/WWP
IPR001478	77	158	PF00595	PDZ/DHR/GLGF
IPR001478	393	474	PF00595	PDZ/DHR/GLGF
IPR001478	516	600	PF00595	PDZ/DHR/GLGF
IPR001478	686	765	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001202	7	39	SM00456	WW/Rsp5/WWP
IPR001478	85	161	SM00228	PDZ/DHR/GLGF
IPR001478	253	323	SM00228	PDZ/DHR/GLGF
IPR001478	401	477	SM00228	PDZ/DHR/GLGF
IPR001478	525	603	SM00228	PDZ/DHR/GLGF
IPR001478	694	768	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001202	6	39	PS50020	WW/Rsp5/WWP
IPR001478	77	145	PS50106	PDZ/DHR/GLGF
IPR001478	245	308	PS50106	PDZ/DHR/GLGF
IPR001478	393	475	PS50106	PDZ/DHR/GLGF
IPR001478	516	603	PS50106	PDZ/DHR/GLGF
IPR001478	686	768	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR001202	12	37	PS01159	WW/Rsp5/WWP

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2843 bp
Genome contig ID	gi65492966r_103340533
PolyA signal sequence (ATTAAA,-10)	+--------+--------+----*----+---- ATCGCTCGTTATTTTTTATATAGATATTAAAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAGTTTGTCGTGCTTTTTTCTAAAACTGTTAGCATCATTTAAAA

Gene/Protein Characteristic Table for mKIAA1634

Features of the cloned DNA sequence

Features of the protein sequence