Order Kazusa clone(s) from : ![]() |
Product ID | ORK05908 |
---|---|
Accession No | AB014605 |
Description | membrane associated guanylate kinase, WW and PDZ domain containing 2, transcript variant 2 |
Clone name | hg03359s1 |
Vector information | |
cDNA sequence | DNA sequence (6795 bp) Predicted protein sequence (1483 aa) |
Flexi ORF Clone | FXC05908 |
Source | Human adult brain |
Rouge ID |
mKIAA0705
by Kazusa Mouse cDNA Project
|
Note | We replaced hg03359, former representative clones for KIAA0705 with hg03359s1. (2003/4/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2234 bp |
---|---|
Genome contig ID | gi89161213r_77384334 |
PolyA signal sequence (AATAAA,-16) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 77484334 | 78920807 | 20 | 99.5 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001478 | 59 | 140 | PF00595 | PDZ/DHR/GLGF |
IPR008144 | 184 | 227 | PF00625 | Guanylate kinase | |
IPR001202 | 346 | 375 | PF00397 | WW/Rsp5/WWP | |
IPR001202 | 392 | 421 | PF00397 | WW/Rsp5/WWP | |
IPR001478 | 468 | 534 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 681 | 722 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 806 | 887 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 948 | 1035 | PF00595 | PDZ/DHR/GLGF | |
IPR001478 | 1175 | 1254 | PF00595 | PDZ/DHR/GLGF | |
HMMSmart | IPR001478 | 68 | 143 | SM00228 | PDZ/DHR/GLGF |
IPR008145 | 149 | 333 | SM00072 | Guanylate kinase/L-type calcium channel region | |
IPR001202 | 345 | 377 | SM00456 | WW/Rsp5/WWP | |
IPR001202 | 391 | 423 | SM00456 | WW/Rsp5/WWP | |
IPR001478 | 476 | 552 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 655 | 725 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 814 | 890 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 957 | 1038 | SM00228 | PDZ/DHR/GLGF | |
IPR001478 | 1183 | 1257 | SM00228 | PDZ/DHR/GLGF | |
ProfileScan | IPR001478 | 59 | 143 | PS50106 | PDZ/DHR/GLGF |
IPR008144 | 151 | 227 | PS50052 | Guanylate kinase | |
IPR001202 | 344 | 377 | PS50020 | WW/Rsp5/WWP | |
IPR001202 | 390 | 423 | PS50020 | WW/Rsp5/WWP | |
IPR001478 | 468 | 537 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 647 | 710 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 806 | 888 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 948 | 1038 | PS50106 | PDZ/DHR/GLGF | |
IPR001478 | 1175 | 1257 | PS50106 | PDZ/DHR/GLGF | |
ScanRegExp | IPR008144 | 183 | 200 | PS00856 | Guanylate kinase |
IPR001202 | 350 | 375 | PS01159 | WW/Rsp5/WWP | |
IPR001202 | 396 | 421 | PS01159 | WW/Rsp5/WWP |
![]() |
---|
Primer_f | CAGCGGCCAGTTTTGTGTTGC |
---|---|
Primer_r | GTACTGATCCAACCCATTCGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAGCGGCCAGTTTTGTGTTGC |
Primer_r | GTACTGATCCAACCCATTCGC |
PCR product length | 135 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |