KIAA0705

Product ID	ORK05908
Accession No	AB014605
Description	membrane associated guanylate kinase, WW and PDZ domain containing 2, transcript variant 2
Clone name	hg03359s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6795 bp) Predicted protein sequence (1483 aa)
HaloTag ORF Clone	FHC05908
Flexi ORF Clone	FXC05908
Source	Human adult brain
Rouge ID	mKIAA0705 by Kazusa Mouse cDNA Project
Note	We replaced hg03359, former representative clones for KIAA0705 with hg03359s1. (2003/4/2)

Length: 6795 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2234 bp
Genome contig ID	gi89161213r_77384334
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ATATTCTAAAACACTGTCAAATAAAATATATATCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATCTTTTCTTTTTCCAACTATATAGGCTGTGTGTTAATTTGAAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	77484334	78920807	20	99.5	Internal No-hit

Length: 1483 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50278	100.0	MAGI2 protein [...	Homo sapiens
EAW77022	100.0	membrane associ...	Homo sapiens
EAW77024	95.6	membrane associ...	Homo sapiens
BAE27976	93.8	unnamed protein...	Mus musculus
XP_001490459	96.4	similar to Memb...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046854	1e-22	50.3	KIAA1634

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	59	140	PF00595	PDZ/DHR/GLGF
	IPR008144	184	227	PF00625	Guanylate kinase
	IPR001202	346	375	PF00397	WW/Rsp5/WWP
	IPR001202	392	421	PF00397	WW/Rsp5/WWP
	IPR001478	468	534	PF00595	PDZ/DHR/GLGF
	IPR001478	681	722	PF00595	PDZ/DHR/GLGF
	IPR001478	806	887	PF00595	PDZ/DHR/GLGF
	IPR001478	948	1035	PF00595	PDZ/DHR/GLGF
	IPR001478	1175	1254	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	68	143	SM00228	PDZ/DHR/GLGF
	IPR008145	149	333	SM00072	Guanylate kinase/L-type calcium channel region
	IPR001202	345	377	SM00456	WW/Rsp5/WWP
	IPR001202	391	423	SM00456	WW/Rsp5/WWP
	IPR001478	476	552	SM00228	PDZ/DHR/GLGF
	IPR001478	655	725	SM00228	PDZ/DHR/GLGF
	IPR001478	814	890	SM00228	PDZ/DHR/GLGF
	IPR001478	957	1038	SM00228	PDZ/DHR/GLGF
	IPR001478	1183	1257	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001478	59	143	PS50106	PDZ/DHR/GLGF
	IPR008144	151	227	PS50052	Guanylate kinase
	IPR001202	344	377	PS50020	WW/Rsp5/WWP
	IPR001202	390	423	PS50020	WW/Rsp5/WWP
	IPR001478	468	537	PS50106	PDZ/DHR/GLGF
	IPR001478	647	710	PS50106	PDZ/DHR/GLGF
	IPR001478	806	888	PS50106	PDZ/DHR/GLGF
	IPR001478	948	1038	PS50106	PDZ/DHR/GLGF
	IPR001478	1175	1257	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR008144	183	200	PS00856	Guanylate kinase
	IPR001202	350	375	PS01159	WW/Rsp5/WWP
	IPR001202	396	421	PS01159	WW/Rsp5/WWP

Primer_f	CAGCGGCCAGTTTTGTGTTGC
Primer_r	GTACTGATCCAACCCATTCGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAGCGGCCAGTTTTGTGTTGC
Primer_r	GTACTGATCCAACCCATTCGC
PCR product length	135 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles