| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK05908 | 
|---|---|
| Accession No | AB014605 | 
| Description | membrane associated guanylate kinase, WW and PDZ domain containing 2, transcript variant 2 | 
| Clone name | hg03359s1 | 
| Vector information | |
| cDNA sequence | DNA sequence (6795 bp) Predicted protein sequence (1483 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC05908
     
     
     | 
| Flexi ORF Clone | FXC05908 | 
| Source | Human adult brain | 
| Rouge ID | 
    mKIAA0705
    
    by Kazusa Mouse cDNA Project
     | 
| Note | We replaced hg03359, former representative clones for KIAA0705 with hg03359s1. (2003/4/2) | 
 Length: 6795 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 2234 bp | 
|---|---|
| Genome contig ID | gi89161213r_77384334 | 
| PolyA signal sequence (AATAAA,-16)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (100000 - 99951)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 7 | r | 77484334 | 78920807 | 20 | 99.5 | Internal No-hit | 
 
        Length: 1483 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR001478 | 59 | 140 | PF00595 | PDZ/DHR/GLGF | 
| IPR008144 | 184 | 227 | PF00625 | Guanylate kinase | |
| IPR001202 | 346 | 375 | PF00397 | WW/Rsp5/WWP | |
| IPR001202 | 392 | 421 | PF00397 | WW/Rsp5/WWP | |
| IPR001478 | 468 | 534 | PF00595 | PDZ/DHR/GLGF | |
| IPR001478 | 681 | 722 | PF00595 | PDZ/DHR/GLGF | |
| IPR001478 | 806 | 887 | PF00595 | PDZ/DHR/GLGF | |
| IPR001478 | 948 | 1035 | PF00595 | PDZ/DHR/GLGF | |
| IPR001478 | 1175 | 1254 | PF00595 | PDZ/DHR/GLGF | |
| HMMSmart | IPR001478 | 68 | 143 | SM00228 | PDZ/DHR/GLGF | 
| IPR008145 | 149 | 333 | SM00072 | Guanylate kinase/L-type calcium channel region | |
| IPR001202 | 345 | 377 | SM00456 | WW/Rsp5/WWP | |
| IPR001202 | 391 | 423 | SM00456 | WW/Rsp5/WWP | |
| IPR001478 | 476 | 552 | SM00228 | PDZ/DHR/GLGF | |
| IPR001478 | 655 | 725 | SM00228 | PDZ/DHR/GLGF | |
| IPR001478 | 814 | 890 | SM00228 | PDZ/DHR/GLGF | |
| IPR001478 | 957 | 1038 | SM00228 | PDZ/DHR/GLGF | |
| IPR001478 | 1183 | 1257 | SM00228 | PDZ/DHR/GLGF | |
| ProfileScan | IPR001478 | 59 | 143 | PS50106 | PDZ/DHR/GLGF | 
| IPR008144 | 151 | 227 | PS50052 | Guanylate kinase | |
| IPR001202 | 344 | 377 | PS50020 | WW/Rsp5/WWP | |
| IPR001202 | 390 | 423 | PS50020 | WW/Rsp5/WWP | |
| IPR001478 | 468 | 537 | PS50106 | PDZ/DHR/GLGF | |
| IPR001478 | 647 | 710 | PS50106 | PDZ/DHR/GLGF | |
| IPR001478 | 806 | 888 | PS50106 | PDZ/DHR/GLGF | |
| IPR001478 | 948 | 1038 | PS50106 | PDZ/DHR/GLGF | |
| IPR001478 | 1175 | 1257 | PS50106 | PDZ/DHR/GLGF | |
| ScanRegExp | IPR008144 | 183 | 200 | PS00856 | Guanylate kinase | 
| IPR001202 | 350 | 375 | PS01159 | WW/Rsp5/WWP | |
| IPR001202 | 396 | 421 | PS01159 | WW/Rsp5/WWP | 
           
	  RT-PCR
	   | 
	  
	  
|---|
 Experimental conditions| Primer_f | CAGCGGCCAGTTTTGTGTTGC | 
|---|---|
| Primer_r | GTACTGATCCAACCCATTCGC | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 7
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | CAGCGGCCAGTTTTGTGTTGC | 
| Primer_r | GTACTGATCCAACCCATTCGC | 
| PCR product length | 135 bp | 
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |